NTR/NRX Define a New Thioredoxin System in the Nucleus of Arabidopsis thaliana Cells

Title: NTR/NRX define a new thioredoxin system in the nucleus of Arabidopsis thaliana cells.

Authors: Corinne Marchal, Valérie Delorme-Hinoux, Laetitia Bariat, Wafi Siala*, Christophe

Belin, Julio Saez-Vasquez, Christophe Riondet and Jean-Philippe Reichheld

5

Address:

Université Perpignan Via Domitia, Laboratoire Génome et Développement des Plantes, UMR 5096,

F-66860, Perpignan, France

CNRS, Laboratoire Génome et Développement des Plantes, UMR 5096, F-66860, Perpignan,

France 10

* Present address: Pharmacologie cellulaire et moléculaire, Louvain Drug Research Institute,

Université catholique de Louvain, Brussels, Belgium.

Corresponding author:

Jean-Philippe Reichheld 15

Laboratoire Génome et Développement des Plantes, UMR 5096 CNRS-UPVD, 58 Avenue Paul

Alduy - Bat T, 66860 Perpignan Cedex

email address : [email protected]

Running title: 20

Nucleoredoxins in Arabidopsis

Short summary:

We have characterized a new thioredoxin system in the nucleus of Arabidopsis thaliana cells. It is

composed of the thioredoxin reductase NTRA and the nucleoredoxin NRX1. Genetic analyses have 25

also shown that NRX1 is involved in pollen fertility.

Molecular Plant Advance Access published November 19, 2013 at B

elgorod State University on N

ovember 24, 2013

http://mplant.oxfordjournals.org/

Dow

nloaded from



Abstract

Thioredoxins (TRX) are key components of cellular redox balance, regulating many target proteins

through thiol/disulfide exchange reactions. In higher plants, TRX constitute a complex multigenic 30

family whose members have been found in almost all cellular compartments. Although

chloroplastic and cytosolic TRX systems have been largely studied, the presence of a nuclear TRX

system has for long been elusive. Nucleoredoxins (NRX) are potential nuclear TRX found in most

eukaryotic organisms. In contrast to mammals which harbour a unique NRX, angiosperms generally

possess multiple NRX organized in three subfamilies. Here, we show that Arabidopsis thaliana has 35

two NRX genes (AtNRX1 and AtNRX2) respectively belonging to subgroups I and III. While NRX1

harbours typical TRX active sites (WCG/PPC), NRX2 has atypical active sites (WCRPC and

WCPPF). Nevertheless, both NRX1 and NRX2 have disulfide reduction capacities although NRX1

alone can be reduced by the thioredoxin reductase NTRA. We also show that both NRX1 and

NRX2 have a dual nuclear/cytosolic localization. Interestingly we found that NTRA, previously 40

identified as a cytosolic protein, is also partially localized in the nucleus, suggesting that a complete

TRX system is functional in the nucleus. We show that NRX1 is mainly found as a dimer in vivo.

nrx1 and nrx2 knockout mutant plants exhibit no phenotypic perturbations under standard growth

conditions. However, the nrx1 mutant shows a reduced pollen fertility phenotype suggesting a

specific role of NRX1 at the haploid phase. 45

Keywords:

Thioredoxin, Nucleoredoxin, Nucleus, Arabidopsis

at Belgorod State U

niversity on Novem

ber 24, 2013http://m

plant.oxfordjournals.org/D

ownloaded from



Introduction 50

Dithiol-disulfide redox modification is a ubiquitous post-translational modification regulating the

structure and the activity of numerous proteins. Thioredoxins (TRX), Glutaredoxins (GRX) and

Protein Disulfide Isomerases (PDI) are involved in the reduction of disulfide bridges (Meyer et al.,

2009). TRX, GRX and PDI belong to the thioredoxin superfamily of proteins, all of which share a

similar tridimensional structure and overlapping biochemical functions. These proteins have a 55

common structure called 'thioredoxin fold' which consists of a stack of -sheets surrounded by -

helices (Holmgren, 1989). The canonical TRX active site (WCG/PPC), located at the surface of the

protein, is composed of a dithiol essential for the disulfide reduction mechanism. The surrounding

amino-acids (Gly/Pro, Pro) are required to determine the reducing capacities of the thioredoxins and

to maintain the conformation of the active site (Holmgren, 1985; Eklund et al., 1991; Roos et al., 60

2007). Moreover, the Trp residue preceding the catalytic Cys is also important for the stability of

the TRX (Roos et al., 2010). Other residues have been demonstrated to contribute to TRX activity,

mainly by maintaining the pKa of the active site. Among them are Asp27, Lys57 (E. coli

numeration) and an amino-acid (generally Ile) just surrounding the highly conserved cis-Pro residue

(Ren et al., 2009; Dyson et al., 1997). 65

The GRX active site is generally less conserved, being composed of dicysteinic or monocysteinic

residues and variable surrounding amino acids (Rouhier et al., 2008). GRX activity is rather distinct

from TRX because they are mainly involved in deglutathionylation activities. Another major

difference is that GRX are generally reduced by the sulfhydryl-containing tripeptide glutathione

(GSH) while TRX are reduced by thioredoxin reductases. Depending on the cellular compartment, 70

thioredoxin reductases are reduced by NAD(P)H or ferredoxin (Meyer et al., 2009).

A characteristic of photosynthetic organisms is the very large number of TRX and GRX genes

encoding proteins located in different cellular compartments. Several groups of 'classical' TRX are

localized in plastids (TRXm, f, x, y, z) where they regulate light-dependent carbon metabolism,

antioxidant stress response and chloroplast development (Lemaire et al., 2007; Vieira Dos Santos 75

at Belgorod State U

niversity on Novem



ownloaded from



and Rey, 2006; Arsova et al., 2010). h and o types TRX are located in mitochondria and the cytosol

(Laloi et al., 2001; Gelhaye et al., 2004; Meng et al., 2009). Most chloroplastic TRX are reduced by

light through the ferredoxin (Fdx)/thioredoxin reductase system (FTR) while the mitochondrial and

cytosolic TRX are generally reduced by NAD(P)H through the NAD(P)H-dependent thioredoxin

reductases (NTR) (Jacquot et al., 1994; Rivera-Madrid et al., 1995; Laloi et al., 2001). Most TRX 80

are soluble proteins, but several members of h-type TRX have been isolated in the endomembrane

and plasma membrane systems (Meng et al., 2009; Traverso et al., 2013). Some TRXh proteins

were shown to predominantly localize to the nucleus in cells under oxidative stress in wheat seeds

(Serrato and Cejudo, 2003). Moreover, evidence of a nuclear TRX system has recently been shown

in wheat seeds (Pulido et al., 2009). 85

In addition to classical TRX, different types of atypical TRX are found in all cellular compartments.

Among them, CxxS, TRX-lilium, TRX-like, Clot are proteins harbouring atypical active sites

(Chibani et al., 2012; Meyer et al., 2012; Serrato et al., 2008). Other homologs like CDSP32, APR,

NTRc, tetratricoredoxin (TDX) or nucleoredoxins (NRX) are multidomain proteins composed of at

least one TRX domain fused to other distinct domains (Serrato et al., 2004; Meyer et al., 2012; 90

Setya et al., 1996; Vignols et al., 2003). Although an increasing number of works have reported the

biochemical and biological functions of some of these isoforms, including NTRc and CDSP32

(Perez-Ruiz et al., 2006, Broin et al., 2002), other members are poorly documented.

NRX were first described in mice as multidomain proteins similar to TRX and conserved between

mammalians (Kurooka et al., 1997). These proteins were first described as strictly nuclear proteins 95

but this statement was revised and the proteins were later found in the cytosol in mice (Funato et al.,

2006). The mouse NRX has a disulfide reduction capacity on insulin but its reducer has not been

identified. In mice, biochemical data suggest that NRX is involved in the redox regulation of the

Wnt/ -catenin signalling pathway, which is essential for early development and stem cell

maintenance. NRX usually interacts with Dishevelled (Dvl), an essential adaptor protein for Wnt 100

signalling, and blocks the activation of the Wnt pathway. Oxidative stress causes dissociation of

at Belgorod State U

niversity on Novem



ownloaded from



NRX from Dvl, which enables Dvl to activate the downstream Wnt signalling pathway (Funato et

al., 2006; 2010a; 2010b). In mammals, NRX is also involved in the NF-kB pathway by negatively

regulating Toll-like receptor 4 signaling via recruitment of flightless-I to myeloid differentiation

primary response genes (Hayashi et al., 2010). A vital function of NRX has been demonstrated in 105

mouse mutants in which a splice-site nrx mutation causes craniofacial defects in the perinatal lethal

line l11Jus13 (Boles et al., 2009). Knocking-down the NRX gene also dramatically affects

embryonic development in Xenopus (Funato et al., 2006). The mammalian NRX was further shown

to physically interact with PP2A phosphatase homologs (Funato and Miki, 2007), with the ER

membrane Sec63 protein and to transactivate several transcription factors in vitro (Müller et al., 110

2011; Hirota et al., 2000).

Plant NRX homologs show limited homology with the mammalian NRX (Chibani et al., 2009). A

maize NRX1 homolog was described as reducing disulfide bonds in vitro and having both cytosolic

and nuclear localization in kernel cells (Laughtner et al., 1998). The Arabidopsis NRX1 was shown

to play a major role in pollen tube growth in the pistil, but not in vitro, suggesting that it integrates 115

signals from the maternal tissue and further guides the pollen tube towards the ovule (Qin et al.,

2009). Recently, the poplar NRX1 subfamily was proposed to be involved among the potential

drivers of the salicylic acid (SA)-modulated network (Xue et al., 2013).

Here, we characterize NRX homolog genes in Arabidopsis thaliana. We showed by a phylogenetic

approach that, in contrast to other vascular plants which contain three subfamilies, Arabidopsis 120

thaliana only has two genes that belong to subgroups I and III. We show that both recombinant

NRX1 and NRX2 proteins present disulfide reduction activity in vitro. Interestingly, we found

NRX1 to be reduced by the cytosolic NTRA thioredoxin reductase and to be partially able to

complement a yeast trx1 trx2 mutant, suggesting that NRX1 behaves like a canonical TRX

homolog. By different approaches, we also provide evidence that both NRX1 and NRX2 are 125

localized in the cytosol and in the nucleus of plant cells. We also found NTR protein to be partially

located in the nuclear fractions, suggesting that NTR/NRX1 constitutes a complete nuclear TRX

at Belgorod State U

niversity on Novem



ownloaded from



system in plants. We isolated knock-out nrx1 and nrx2 mutant plants. Although both mutant plants

do not show obvious phenotypic perturbations under standard growth conditions, the nrx1 mutants

exhibit a lower pollen fertility phenotype. 130

Results

Plant NRX constitute three distinct subgroups

In order to study the distribution of NRX in the eukaryotic kingdom, we collected NRX sequences 135

from fully sequenced organisms and constructed a phylogenetic tree based on their amino acid

sequences (Figure 1). NRX are absent in prokaryotic cells and some unicellular eukaryotes, like

yeast and the unicellular green algae O. taurii. However, they are found as a unique copy in

vertebrates in which they constitute a rather homogenous family. They contain an atypical N-

terminal TRX domain exhibiting an uncharacterized CxxSAPC followed by a typical TRX domain 140

harbouring a WCGPC active site, and a PDI-like C-terminal domain (Figure 2). In green algae, a

complex NRX gene family organization was previously discussed by Chibani et al. (2009).

NRX sequences from angiosperms are divergent from mammalian NRX. All are devoid of the C-

terminal PDI domain but instead contain a ~200 aa Cys-rich C-terminal domain (Figure 2 and

Supplemental figure 1) (Chibani et al., 2009). They can be classified in three subgroups depending 145

on the number of the TRX-like domains (Figure 1). Type I NRX is generally 500-600 aa, containing

three TRX-like domains (Figure 2). The first and third domains harbour both typical WCG/PPC

redox site, while the second domain is an atypical TRX domain without any canonical TRX active

site (Supplemental Figure 1). Type II and type III NRX only contain two TRX domains (Figure 2).

While type II NRX contain atypical active sites (WYP/AK/PC and W/R/HCL/A/V/RPC/G), type III 150

contain a highly conserved WCRPC redox site in the first TRX domain and generally a typical Trx

active site (WCPPC/F/S) in the second domain (Supplemental figure 1). Therefore, in contrast to

vertebrates which contain a unique NRX, all plants contain several NRX genes. Moreover, the

at Belgorod State U

niversity on Novem



ownloaded from



number of genes varies from one species to another. Most have at least one copy of each NRX

clade. However, poplar, grapevine or rice contain multiple copies of NRX1, presumably due to gene 155

duplication (Figure 1). Intriguingly, only two genes encoding type I (NRX1) and type III (NRX2) are

found in the nuclear genome of A. thaliana.

All three types of NRX genes harbour introns at the same position: 18 amino acids upstream of the

putative active site of each TRX domain (Supplemental figure 1). Interestingly, h and f-type TRX

also exhibit a conserved intron at the same position, closely upstream from the active site (Sahrawy 160

et al., 1996). Although intron position cannot be considered definitive proof, this suggests that both

NRX, TRXh and TRXf derive from a common ancestral gene.

Arabidopsis NRX1 and NRX2 display disulfide reduction activities

In order obtain insight into the disulfide reduction activity of NRX1 and NRX2, cDNAs from NRX1 165

and NRX2 genes were cloned in a protein expression vector. N-terminal His-tagged NRX1 and

NRX2 proteins were expressed as recombinant proteins in E. coli (Figure 3A). Unfortunately, both

proteins were found in inclusion bodies. In order to partially solubilize them, crude extract pellets

were subjected to a treatment with a basic buffer (pH 12). After centrifugation, the supernatant was

re-neutralized at pH7. This treatment led to a partial solubilization of both proteins (Figure 3A). The 170

soluble NRX1 and NRX2 were subjected to a insulin-disulfide bridge reduction test using DTT as a

reducing power (Figure 3B). Both proteins exhibit disulfide bridge reduction capacities, the activity

of NRX1 being higher than that of NRX2 (Figure 3B). However, their activity is somehow weaker

than the canonical cytosolic AtTRXh3. We further studied whether the cysteine-rich C-terminal

domain affects the disulfide reduction capacities of NRX1. An NRX1-Cterm protein was purified 175

and tested in the same conditions. The truncated protein was still insoluble and was submitted to the

same pH treatment as full-length proteins. The activity of the truncated protein was not significantly

different from the full length protein, indicating that the C-terminal domain does not affect the

NRX1 disulfide reduction activity. Therefore, both NRX1 and NRX2 proteins display disulfide

at Belgorod State U

niversity on Novem



ownloaded from



bridge reduction activity. 180

Native NRX1, but not NRX2, is reduced by NTRA

We next attempted to find the physiological reducer of NRX. The activities of NRX1, NRX1-

Cterm and NRX2 proteins were tested in the presence of cytosolic/mitochondrial AtNTRA or

AtNTRB thioredoxin reductases (Reichheld et al., 2005). Neither NTRA nor NTRB were able to 185

reduce NRX1 or NRX2 in the insulin reduction assay (data not shown). We suspected that the pH-

mediated solubilization of NRX proteins might have partially denaturate the proteins, preventing

their reduction by NTR. We next tested different production conditions to isolate native soluble

NRX. Producing the recombinant proteins at 4°C for 3 days allowed us to recover soluble fractions

of NRX1 and NRX2 proteins. However, the NRX1-Cterm protein was still fully insoluble. Both 190

soluble NRX1 and NRX2 protein fractions were tested for insulin reduction. Interestingly, when we

studied the reduction of NRX1 by the NADPH/NTRA system, we detected significant insulin

reduction activities, indicating that the native NRX1 can be reduced by NTRA. We determined the

affinity of NTRA for NRX1 to be Km=0.45 µM (Figure 4). However, no reduction of NRX2 by

NTRA was found (data not shown). Some TRX have been shown to be reduced by alternative 195

systems like the GR/GSH/GRX system (Gelhaye et al., 2003; Reichheld et al., 2007; Koh et al.,

2008). We measured the capacity of GRXC1 or GRXC2 to reduce NRX1 or NRX2 in the presence

of NADPH, cytosolic GR1 and GSH. None of these proteins were able to reduce NRX in the insulin

reduction assay (data not shown).

200

NRX1, but hardly NRX2, is able to partially complement the S. cerevisiae trx1 trx2 mutant

In order to get further insight into NRX activity in vivo, we tested whether NRX can complement a

yeast trx1 trx2 double mutant. The inactivation of both TRX1 and TRX2 in budding yeast leads to

marked phenotypic perturbations including hypersensitivity to H2O2 due to the lack of reduction of

Trx-dependent peroxidases, hypersensitivity to methionine sulfoxide (MetO) due to the lack of 205

at Belgorod State U

niversity on Novem



ownloaded from



reduction of the MetO reductase and auxotrophy to methionine due to inefficient reduction of PAPS

reductase (Muller 1991). When expressed in the yeast trx1 trx2 mutant, neither NRX1 nor NRX2

complement the auxotrophy to methionine and hypersensitivity to MetO, indicating that none of

them are able to complement the mutant for the reduction of PAPS reductase and MetO reductase.

However, NRX1 is able to partially complement the hypersensitivity of the mutant to H2O2 210

treatment (Figure 5), although this activity is rather weak compared to the complementation by the

yeast ScTRX1 and ScTRX2. NRX2 is much less efficient in this reaction. Nevertheless, these data

indicate that NRX1 is likely acting as a functional electron donor for yeast peroxiredoxins.

Both NRX1 and NRX2 are cytosolic/nuclear proteins 215

To gain more insight on NRX1 and NRX2 gene expression in plants, we studied the steady state

levels of the two transcripts in different plant organs by RT-PCR. Both genes are expressed in all

studied organs and show similar expression profiles (Supplemental figure 2A). We also aimed to

study the accumulation of NRX proteins in plant organs. Therefore, we generated a specific

antibody directed against the NRX1 protein whose specificity was tested against a KO nrx1 mutant 220

(Supplemental figure 3). As shown in Supplemental figure 2B, NRX1 proteins accumulate in all

studied plant organs, although a bit higher in flower buds than in other organs. However, we have so

far failed to generate anti-NRX2 antibodies.

We next aimed to study the subcellular localization of NRX1 and NRX2. We analysed NRX1

protein abundance in purified nuclear and cytosolic fractions from wild-type Arabidopsis flowers. 225

NRX1 was found in both fractions, indicating that the protein has a dual cytosolic/nuclear

localization (Figure 6M). Interestingly, we also found the cytosolic NTR protein to be partially

located in the nuclear compartment. In order to ascertain that the nuclear fractions were not

contaminated by the cytosol, we studied the expression of two well characterized cytosolic TRX

(TRXh3 and TRXh5). These proteins are only found in the cytosolic compartment. Moreover, the 230

fractions were tested for an exclusive nuclear protein: Nucleolin 1 (Nuc1) (Pontvianne et al., 2010).

at Belgorod State U

niversity on Novem



ownloaded from



Here, a specific signal was found in the nuclear fraction, confirming purity of the respective

fractions.

We next performed immunolocalization in Arabidopsis root tips using the anti-NRX1 antibody. The

protein was found in both the cytosolic and the nuclear compartements and was excluded from the 235

nucleolus (Figure 6A-I). Moreover, a similar dual nuclear/cytosolic cellular localization was found

for the NRX1:GFP and NRX2:GFP fusion proteins which was expressed in tobacco cells

(Supplemental figure 4). Therefore, NRX1 and NRX2 proteins are localized in the cytosol and the

nucleoplasm and are apparently excluded from the nucleolar compartment.

In order to confirm the partial nuclear localisation of NTR, we also immunolocalized NTR in root 240

tips (Figure 6J-L) and expressed NTRA:GFP fusion proteins in BY-2 cells (Supplemental figure 4).

Interestingly, similarly to NRX1, we showed a subcellular cytosolic/nuclear localization of NTR,

suggesting that both proteins are localized in the same compartments, at least in root tip cells.

NRX1 forms a dimer in vivo 245

In a first attempt to find NRX1 interactors in vivo, we performed a gel filtration experiment using

total soluble protein extracts prepared from Arabidopsis flower buds. These extracts were

fractionated through a size fractionation Sephacryl S300 column equilibrated with 0.5 M KCl buffer

(Figure 7A). Western blot analyses of eluted fractions revealed that the peak of NRX1 protein

eluted at ~140-170 kDa (lanes 59–67). The estimated size corresponds approximately to twice the 250

predicted molecular weight of NRX1 (~70 kDa), suggesting that the NRX1 protein forms a dimer.

Moreover, we did not detect any signal in fractions (lanes 77-79) corresponding to the molecular

weight of the monomeric protein, suggesting that the vast majority of the protein is in the dimeric

form. Although these data suggest that the NRX1 protein forms a dimer in vivo, we cannot rule out

that the protein is associated with another protein of a similar molecular weight. In order to confirm 255

our hypothesis, we performed a similar gel filtration experiment using the recombinant NRX1

protein. While monitoring the protein level in the different elution fractions, we detected two peaks,

at Belgorod State U

niversity on Novem



ownloaded from



the major one being at a molecular weight of ~130-140 kDa, and a minor one just below 75 kDa

(Figure 7B). Western-blots indicated that the corresponding protein is NRX1, confirming that the

major part of the recombinant NRX1 protein is associated as a dimer in vitro. 260

In order to determine whether the formation of the dimer is redox dependent, protein extracts were

first subjected to different reducing treatments before migration on a denaturing polyacrylamide gel.

As shown in Supplemental figure 5, NRX1 proteins with or without DTT treatment remained as

monomers, suggesting that the formation of the dimeric form is not redox dependent but rather

stabilized by electrostatic interactions which are destroyed by SDS-PAGE conditions. 265

nrx1 mutants are partially pollen sterile

In order to get more insight into the function of NRX in plant, we isolated T-DNA insertion mutants

in both genes (Supplemental figure 3A). Two mutant alleles from the SALK library (Alonso et al.,

2003) were isolated in the NRX1 gene (nrx1-401: SALK_113401 and nrx1-340: SALK_021340) 270

and one in the NRX2 gene (nrx2: SALK_021735). The insertions were precisely mapped by PCR

(Supplemental figure 3A) and the absence of mRNA encoding for NRX1 and NRX2 mRNAs

respectively was tested by RT-PCR (Supplemental figure 3B). No NRX1 protein was detected in

both nrx1 alleles and no cross-reaction was found with NRX2 by Western-blot analyses, confirming

that the nrx1 mutants are KO lines and that anti-NRX1 antibodies are specific (Supplemental figure 275

3C). Genotyping of the T3 progeny led to an unexpected ratio of T-DNA segregation, suggesting

that the nrx1 mutations do not follow a Mendelian segregation (Figure 8A). Both nrx1-401 and

nrx1-340 mutant lines show higher rates of wild-type progenies, whereas the nrx2 mutant has an

expected segregation ratio. This non-Mendelian segregation of nrx1 might have a gametophytic or

embryonic origin. Embryonic and female gametophytic disorders are usually visualized by aborted 280

seeds in siliques. However, we did not observe any aborted seeds in the siliques of NRX1/nrx1

heterozygous plants (data not shown).

To further test whether the nrx1 mutation affects male fertility, pollen of NRX1/nrx1 mutant plants

at Belgorod State U

niversity on Novem



ownloaded from



was transferred to wild-type stigma. Progeny testing identified only 40% of plants segregating the

nrx1 mutation, which clearly diverges from the expected ratio (50/50) (Figure 8B). Anthers of 285

NRX1/nrx1 plants did not reveal lethality of pollen grains by Alexander staining (data not shown).

The reciprocal cross did result in 50% NRX1/nrx1 plants, which again confirmed that female

transmission of the defective nrx1 allele was normal. This indicates that the nrx1 mutation affects

pollen fertility. To confirm this observation, the presence of NRX transcripts was measured in

mature pollen. Semi-quantitative RT-PCR indicated that NRX1 was expressed in pollen, whereas no 290

signal could be detected for NRX2 (Figure 8C). In flowers, both NRX mRNAs were detected. These

data indicate that NRX1 but not NRX2 plays a role in pollen fertility. Further analysis of nrx1 and

nrx2 homozygote mutants does not show any phenotype in the diploid phase (Supplemental figure

6).

295

Discussion

Nucleoredoxins are conserved in multicellular organisms

Nucleoredoxins have been defined as a class of atypical TRX-like proteins (Meyer et al., 2008). In

contrast to classical TRX which are generally small proteins containing a single TRX domain, 300

nucleoredoxins are multidomain proteins. Genomic analyses by ourselves and others suggested that

the presence of NRX is a feature of eukaryotic organisms. Nevertheless, yeast and other unicellular

eukaryotes like some unicellular green algae (Ostreococcus) are devoid of NRX, suggesting that

NRX genes have been lost in some clades. Interestingly, the number of NRX genes has dramatically

increased in most angiosperms. On the basis of amino acids sequence similarities, three types of 305

NRX genes can clearly be defined (Chibani et al., 2009). While types II and III NRX genes are

generally represented by unique copies, type I NRX have undergone multiple duplication events in

several plants like poplar, rice and grapevine. The Arabidopsis genome constitutes a rather unique

situation in angiosperm plants in which only two genes from types I and III are found, suggesting

at Belgorod State U

niversity on Novem



ownloaded from



that type II has been lost during evolution. Indeed, type II NRX seems to be the most atypical NRX-310

like protein, since it does not exhibit any canonical TRX active site in its two TRX domains.

Whether these proteins act as disulfide reductases is still to be determined.

Another specific feature of angiosperm NRX is the cysteine-rich C-terminal domain. Although

other multidomain TRX or GRX are found in plant genomes, no other proteins share this specific

domain (Meyer et al., 2012). In contrast, mammalian NRX exhibit a PDI domain at the C-terminus, 315

suggesting that they have a distinct origin. Although the cysteine-rich C-terminal domain of

angiosperm NRX has been proposed to be a Zinc-binding domain (Laughner et al., 1998; Zhang et

al., 1995; Chen et al., 2008), this statement has never been tested yet. We demonstrated that the

NRX1 protein is predominantly found in a dimeric form in vivo. Although further analyses will aim

to determine how this dimeric structure is maintained, the cysteine-rich C-terminal domain is a 320

good candidate to be involved in dimerization.

Plant NRX1 defines a nuclear NAD(P)H-dependent TRX system

A disulfide reduction capacity of NRX homologs has been demonstrated previously for the mice

NRX and the maize type I NRX, using DTT as a strong reducer (Funato et al., 2006; Laughner et 325

al., 1998). Both type I (NRX1) and type III (NRX2) from A. thaliana show disulfide reduction

activities, indicating that both proteins are disulfide reductases. Nevertheless, their activity is lower

than the classical TRXh3 in the insulin reduction test. These data somehow contrast with Laughner

et al (1998) which proposed that the activity of the ZmNRX1 is similar to that of Spirulina TRX.

Nevertheless, it should be mentioned that in the latter study, the concentrations of the respective 330

recombinant proteins (SpTRX and ZmNRX) were different, which clearly limits the conclusions

(Laughtner et al, 1998). AtNRX1 exhibits two canonical TRX active sites (WC54GPC57 and

WC375PPC378). Therefore, this protein is expected to have TRX activity. AtNRX2 harbours two

atypical active sites (WC54RPC57 and WC215PPF218). In spite of this, its disulfide reduction

capacities are similar to those of AtNRX1, suggesting that at least one of these TRX domains is 335

at Belgorod State U

niversity on Novem



ownloaded from



active as a disulfide reductase. Our knowledge about the functionality of atypical TRX active sites

is limited. Mechanistically, the monocysteinic WCPPF is unfavored by the replacement of the

resolving Cys215 by a Phe215 amino-acid. Monocysteinic glutaredoxins exhibit disulfide reduction

capacities but mainly act through deglutathionylation, the resolving cysteine being replaced by a

glutathione molecule (Meyer et al., 2009). In contrast to GRX, NRX2 does not exhibit a 340

glutathione binding motif, contradicting the idea that NRX2 might act as a GRX. Moreover, our

data show no reduction of either of the AtNRX by the NADPH/GR/GSH system. The dicysteinic

WC54RPC57 active site is more likely involved in the disulfide reduction capacities of NRX2. Here,

the Gly/Pro residue adjacent to the catalytic Cys54, involved in the conformation of the active site, is

replaced by an Arg. Recent studies on the atypical TRX-like2.1 in poplar, demonstrated the 345

disulfide reduction functionality of the WCRKC active site (Chibani et al., 2012). Indeed, this TRX-

like isoform was shown to be glutathionylated and is reduced by the NADPH/GR/GSH system

instead of the NADPH/NTR system. Unfortunately, we have not succeeded in identifying the

physiological reducer of NRX2 yet. However, production of recombinant NRX1 at 4°C allowed us

to purify a fraction of soluble proteins. NRX1 is efficiently reduced by the NADPH/NTRA system 350

(Km=0.45 µM) but not by the NADPH/GR/GSH system, clearly indicating that NRX1 is an NTR-

dependent TRX-like protein. Nevertheless, our yeast trx1 trx2 mutant complementation

experiments suggest that NRX1, and even more so NRX2, is inefficient in complementing the

functions of yeast TRX. Only the sensitivity to H2O2 was partially complemented by NRX1 and

hardly at all by NRX2. This is likely due to the fact that yeast target proteins, such as the 355

peroxiredoxin YLR109 are poorly reduced by NRX when tested in vitro (data not shown). Efforts to

find physiological targets of NRX will have to be done.

The subcellular localization of nucleoredoxins has been prone to debates. The name

"nucleoredoxin" was originally given to the mouse protein, due to its exclusive nuclear localization

(Kurooka et al., 1997). However, work from Funato et al. (2006) clearly disagreed with this 360

statement and found NRX to be mainly cytosolic. Its relocation under stress conditions is still a

at Belgorod State U

niversity on Novem



ownloaded from



working hypothesis. Here, we demonstrated by different approaches (western-blots on purified

subcellular fractions, immunolocalization, GFP-fusions) that both NRX1 and NRX2 are localized in

the nuclear compartement, despite lacking a clear NLS sequence. Subnuclear observations indicate

that the protein is in the nucleoplasm but is likely excluded from the nucleolus. Interestingly, 365

different approaches indicate that the cytosolic/mitochondrial NTR are also present in the nuclear

compartment, and apparently in the same subnuclear compartement (nucleoplasm). Although

quantitations of the fraction of nuclear NAD(P)H or of the NAD(P)H/NAD(P)+ ratio are missing in

plants, significant concentrations of free nuclear NADH (~100 nM) were detected by NADH

sensors or fluorescence lifetime measurements in mammals cells (Zhang et al., 2002; Fjeld et al., 370

2003; Hung et al., 2011), suggesting that a complete NADPH-dependent NTR/NRX1 thioredoxin

system is found in the nuclear compartment.

Therefore, it will be of particular interest to identify nuclear targets of the NADPH/NTR/NRX

thioredoxin system in plants.

375

NRX are dispensable for plant development but NRX1 is involved in pollen fertility.

Our present results suggest a specific role of NRX1 during the haploid phase. Cross-pollination

experiments showed that this phenotype can be attributed to the male gametophyte, whereas oocytes

of the mutant are viable. NRX1 was previously isolated among genes induced during pollen tube

growth and a genetic approach suggested NRX1 to be required for pollen tube navigation through 380

the pistil (Qin et al., 2009). While using different nrx1 mutant backgrounds, our data support this

hypothesis. Nevertheless, further experiments are needed to understand how NRX1 is involved in

pollen fertility. Interestingly, we previously described pronounced pollen fertility perturbations in

the thioredoxin reductases double mutant ntra ntrb (Reichheld et al., 2007). Since NRX1 is reduced

by NTR, it is tempting to propose that an inefficient reduction of NRX1 in the ntra ntrb gametes is 385

responsible for the defect in pollen fitness. Nevertheless, the fact that pollen fitness is only partially

perturbed in the nrx1 and the ntra ntrb mutants suggests that the NTR/TRX system is not exclusive

at Belgorod State U

niversity on Novem



ownloaded from



for pollen fitness. Interestingly, we showed previously that a ntra ntrb gr1 mutant is pollen sterile,

indicating that the NTR/TRX system functionally overlaps with the cytosolic glutathione reductase

(GR1) for pollen fitness (Marty et al., 2009). This suggests that NRX1 shares common functions 390

with other reductases (i.e. GR1-dependent) in pollen.

The nrx1 and nrx2 single knockout mutants do not show any visible phenotypic modification in the

diploid phase, suggesting that NRX1 or NRX2 are dispensable for plant development, at least under

the growth conditions we have tested so far. Indeed, most single trx and grx mutants characterized

so far failed to show a phenotype, probably related to the high redundancy between members of 395

these multigenic families (reviewed in Reichheld et al., 2010). Functional overlap between NRX1

and NRX2 has to be considered, based on the fact that both genes appear to be ubiquitously

expressed in plant organs, except in pollen (Supplemental figure 2 and Figure 8C). However,

several other lines of evidence argue against an overlapping function of NRX1 and NRX2. Firstly,

the two genes are not grouped in the same NRX subfamily and share rather low sequence identities 400

(30%). Secondly, they exhibit a different number of domains and distinct redox sites. Thirdly, they

appear to be regenerated by different reduction systems. Moreover, preliminary analysis of a double

nrx1 nrx2 homozygous mutant did not reveal a more pronounced pollen phenotype (viability and

fertility) compared to the single nrx1 (data not shown) mutant and have no obvious phenotype at the

diploid phase either (Supplemental figure 6). 405

In contrast to plants, knock-out and knock-down of the mammalian nrx gene have been shown to

lead to severe phenotypic perturbations, including embryonic lethality. Although, it is not

established that these phenotypes are related to a redox dependent function of NRX, a redox-

dependent regulation of Wnt–β catenin signaling through NRX has been proposed to regulate cell

proliferation under oxidative stress conditions (Funato et al., 2006; Boles et al., 2009). Therefore, 410

future experiments will aim to evaluate the functions of Arabidopsis NRX in plants subjected to

stress conditions.

In summary, our study describes a new TRX system which is located both in the nuclear and in the

at Belgorod State U

niversity on Novem



ownloaded from



cytosolic compartments in Arabidopsis. This system is composed of two nucleoredoxins (NRX1

and NRX2) for which at least NRX1 is reduced by the thioredoxin reductase NTRA. Although the 415

physiological functions and the respective protein targets of both NRX will have to be determined

in future studies, our genetic data strongly suggest that NRX1 is involved in plant fertility by acting

on pollen fitness.

Methods 420

Plant Materials, Growth Conditions, Pollen competition and viability.

Seedlings and plants from Arabidopsis thaliana ecotype Col-0 (wild-type, and SALK mutant lines)

were used for the experiments. T-DNA mutant lines were provided by the SALK laboratory (Alonso

et al., 2003) (http://www.Arabidopsis.org). Homozygous knock-out plants were identified by PCR 425

using gene-specific primers and primers binding to the left border of the T-DNA.

For in vitro seedlings, seeds were surface-sterilized and plated on half-strength MS medium

including Gamborg B5 vitamins (M0231; Duchefa), 1% (w/v) sucrose, and 0.8% (w/v) plant agar.

For plant growth in soil, seeds were sown in pots containing a mixture of soil and vermiculite (3:1,

v/v) and irrigated with water. Both plants and seedlings were grown at 22°C and 70% hygrometry 430

under a 16-h light (200 µE)/8-h dark regime.

Pollen competition and pollen viability experiments were performed as described (Reichheld et al.,

2007). Isolated spores from male gametophyte were obtained as described in Marty et al., (2009).

Gene Expression Analysis by RT-PCR 435

Total RNA was extracted from frozen plant organs using TRIzol reagent (Gibco BRL) according to

the manufacturer’s protocol. For RT-PCR, 5 mg of DNase I–treated total RNA was used for first-

strand synthesis of cDNA using oligo(dT) primer reverse transcription with the Moloney murine

leukemia virus reverse transcriptase as described by the manufacturer’s protocol (First-Strand RT-

at Belgorod State U

niversity on Novem



ownloaded from



PCR kit, ProSTAR; Stratagene). PCR was performed as described by Laloi et al. (2004). 440

Protein Purification, antibodies production and Protein Gel Blot Analysis.

NRX1 and NRX2 coding sequences were clonedin pET16b (Novagen) or pDEST17 (Invitrogen)

expression plasmids and recombinant proteins were expressed by Escherichia coli BL21 cells.

Cells were grown at 37 °C or 4°C to an OD600nm of 0.8 in selective media containing 50 µg/mL 445

kanamycin. Protein expression was induced by adding IPTG to a final concentration of 1 mM and

cells were harvested after 3 h. Cells were pelleted by centrifugation and resuspended in 50 mM

Tris-HCl pH 8, 250 mM NaCl buffer supplemented with 0.5 mM PMSF. After sonication the cell

debris was pelleted by centrifugation and filtered through a 45 µm sterile filter. Soluble proteins

were loaded on a Ni2+

-NTA column (Amersham) for 30 min with a flow rate of 1 mL min-1

. The 450

loaded column was washed with 10 mL wash buffer (50 mM Tris-HCl, pH 8/250 mM NaCl/80 mM

imidazole). Finally, the N-terminal His-tagged NRX proteins was eluted with elution buffer (wash

buffer with 250 mM imidazole). The protein concentration was determined using a Bradford

method.

Antiserum against AtNRX1 and AtNRX2 was generated by injection of purified recombinant 455

protein in rabbit (Eurogentec). For protein gel blot analysis, 15 µg of extracted proteins were

separated by discontinuous SDS/ PAGE in MiniProtean II cells according to Laemmli (Bio-Rad).

Proteins were transferred to nitrocellulose using the Mini Trans-Blot system (BioRad).

Subsequently, the membrane was blocked over night at room temperature with 5% Milk powder in

TBS (20 mM Tris/137 mM NaCl, pH 7.6) supplemented with 0.1% (vol/vol) Tween 20. The 460

membrane was washed 3 times with 0.5% Milk powder in TBS and 0.01% Tween and incubated

with primary antiserum at dilution of 1:10000 for 3 h. After washing 3 times for 5 min with 0.5%

Milk powder in TBS, the membrane was incubated with secondary antibody [Anti-rabbit IgG-

Alkaline Phosphatase

(AP) Conjugate, 1:10,000] for 1 h and washed twice with AP buffer (100 mM Tris1⁄7HCl, pH 465

at Belgorod State U

niversity on Novem



ownloaded from



9.5/100 mM NaCl/50 mM MgCl2). The AP reaction was carried out by adding the substrate

nitroblue secondary antibody [Anti-rabbit IgG-Alkaline Phosphatase tetrazolium/5-bromo-5-chloro-

3-indolyl phosphate (Roche).

Enzymatic Activities 470

NRX and TRXh3 activity was determined using the insulin-disulfide reduction assay as described

(Laloi et al., 2001). The reaction was initiated by the addition of 0.13 mM bovine insulin (Sigma-

Aldrich) to 0.5 mL of 0.1 M potassium phosphate buffer, pH 7.0, containing 2 mM EDTA, and in

first experiments 1 mM DTT as reductant. NRX activity was measured at 20°C and defined as the

increase rate of turbidity at OD at 650 nm due to insulin precipitation. The activity of NRX with 475

thioredoxin reductase as reductant was assayed with 10 µM FAD, 0.5 mM NADPH (Sigma-

Aldrich), different concentrations of NRX proteins, and 1 µM of AtNTRA or AtNTRB. The

reduction by the GR/GSH/GRX system was assayed using 0.1 µM AtGR1, 1mM GSH and 2 µM

AtGRXC1 or AtGRXC1 (Riondet et al., 2012). The consumption of NADPH was followed

spectrophotometrically at 340 nm at 20°C during 15 min and the initial rate of NADPH 480

consumption was used to measure the activity.

Yeast strains, expression constructs and growth assay

Functional complementation assays were done in the strain EMY63 (MATa ade2-1 ade3-100 his3-

11 leu2-3 lys2- 801 trp1-1 ura3-1 trx1::TRP1, trx2::LEU2) as described by Brehelin et al. (2000). 485

Arabidopsis NRX1 and NRX2 were cloned in-frame in the yeast high-copy number plasmid pFL61

using the NotI–NotI polylinker sites (Minet et al., 1992). All strains were transformed after acetate

chloride treatment. Transformants were selected on solid yeast extract nitrogen base (YNB) medium

containing appropriate auxotrophic supplements. Strains transformed by pFL61 were grown and

harvested in exponential phase culture. Sensitivity to oxidants was determined on YNB (added to 490

auxotrophic supplements) plates with or without methionine, methionine sulfoxide or hydrogen

at Belgorod State U

niversity on Novem



ownloaded from



peroxide (Sigma-Aldrich), by spotting 1:10 serial dilution and recording growth after 5 days of

incubation at 30°C.

Gel filtration chromatography 495

Flower bud extracts were prepared in protein extraction buffer (PEB, 20 mM Tris–HCl pH 7.9, 0.2

mM EDTA, 20% Glycerol) containing 500 mM KCl (PEB500), centrifuged for 20 min at 48 400g

and the supernatant filtered through a 0.45 µm filter (Gelman Sciences). Approximately 400 mg of

soluble proteins were loaded directly onto a Hi-Prep 16/60 Sephacryl S300 HR (GE Healthcare)

column equilibrated and run either in PEB500. For western blot analysis, 200 ml of 1 ml fractions 500

were precipitated with 4 volumes of cold acetone and the pellet dissolved in SDS loading buffer.

The protein standards for size estimation of NRX1 were -amylase (200 kDa), alcohol

dehydrogenase (150 kDa), Coalbumine (75 kDa) and BSA (66 kDa) (Sigma-Aldrich).

Whole mount root tip immunolocalisation 505

The 5-day-old Arabidopsis seedlings were fixed in 4% paraformaldehyde in MTSB (50 mm PIPES,

5 mm EGTA, 5 mm MgSO4, pH 7 adjusted with KOH) for 1 h using vacuum infiltration. Samples

were washed with MTSB/0.1% Triton (3 × 5 min) and with deionised water (2 × 5 min). Cell walls

were digested with 2% driselase in MTSB for 45 min, and samples were washed with MTSB/0.1%

Triton (3 × 5 min). Samples were incubated with 10% DMSO/3% NP-40 in MTSB for 1 h. 510

Seedlings were then pre-incubated in 2% BSA/MTSB (1 h, room temperature) and incubated with

the primary antibody (1:500 rabbit anti-Arabidopsis NRX1 or 1:5000 rabbit anti-Arabidopsis NTR)

in 3% BSA/MTSB (O/N, 4°C). After extensive washing with MTSB/0.1% Triton (8 × 10 min), the

seedlings were incubated in 3% BSA/MTSB for another 3 hours (37°C) with 1:1000 of Alexa 488-

conjugated goat anti-rabbit secondary antibody. Finally, the samples were washed with MTSB/0.1% 515

Triton (5 × 10 min) and deionised water (5 × 10 min) and mounted in Vectashield mounting

medium with DAPI (1 μg ml−1) (Vector Laboratories Inc., http://www.vectorlabs.com/).

at Belgorod State U

niversity on Novem



ownloaded from

http://www.vectorlabs.com/



Squashed root tip immunolocalisation

Root tips were prepared as described (Liu et al., 1993; Friesner et al., 2005) with minor 520

modifications: root tips were fixed for 45 min in 4% paraformaldehyde in PME [50 mm piperazine-

N,N′-bis(2-ethanesulphonic acid) (PIPES), pH 6.9; 5 mm MgSO4; 1 mm EGTA] and then washed 3

× 5 min in PME. Root tips were digested for 45 min in 1% (w/v) cellulase, 0.5% (w/v) cytohelicase,

1% (w/v) pectolyase (Sigma, http://www.sigmaaldrich.com/, refs C1794, C8274, P5936) prepared

in PME and then washed 3 × 5 min in PME. They were then squashed gently onto slides as 525

described (Liu et al., 1993), air dried and stored at −80°C.

Immunostaining was performed as described (Friesner et al., 2005) with the following

modifications. Each slide was incubated overnight at 4°C in the following blocking buffer (3%

BSA, 0.05% Tween-20 (Sigma) in 1× PBS) containing 1:500 rabbit anti-Arabidopsis NRX1

antibody. Slides were washed 3 × 5 min in 1× PBS solution and then incubated for 2–3 hours at 530

room temperature in blocking buffer containing 1:1000 Alexa 488-conjugated goat anti-rabbit

secondary antibodies (Molecular Probes, Invitrogen, http://www.invitrogen.com). Finally, slides

were washed 3 × 5 min in PBS and mounted in Vectashield mounting medium with DAPI (1 μg

ml−1) (Vector Laboratories Inc., http://www.vectorlabs.com/).

535

Microscopy

Confocal microscopic observations were carried out using the Axio observer Z1 microscope with

the LSM 700 scanning module, the ZEN 2010 software (Zeiss) and the DAPI (BP 420-480) and

Alexa 488 (BP 490-555) filters.

540

Sequence analysis and tree constructions

Phylogenetic trees were constructed using ClustalW (neighbour-joining method), with a weight

matrix of Gonnet type and visualized using NJplot unrooted software (Strasbourg, France).

at Belgorod State U

niversity on Novem



ownloaded from

http://www.vectorlabs.com/



Accession Numbers 545

Sequence data for NRX1, NRX2, NTRA, NTRB, TRXh3, EF1, SPIK and ACT2 can be found in

the GenBank/EMBL data libraries under accession numbers AEE33684 (At1g60420), AEE85881

(At4g31240), NM 127297 (At2g17420), Z23109.1 (At4g35460), NM 123664 (At5g42980),

AEE28216 (At1g07940), Q8GXE6 (At2g25600) and NM 112764.2 (At3g18780), respectively.

550

Acknowledgments

We thank Yves Meyer and Richard Cooke for fruitful discussions and for critical reading of the

manuscript. We thank the ABRC for T-DNA insertional mutants. We gratefully acknowledge Yvette

Chartier and Jocelyne Guilleminot-Montoya for technical assistance for protein production. This

work was supported by the Centre National de la Recherche Scientifique, the Agence Nationale de 555

la Recherche (ANR-Blanc Nucleoredox 06-0047 and ANR-Blanc Cynthiol 12-BSV6-0011).

References

Alonso, J.M., et al. (2003). Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 560

301:653–657.

Arsova B, Hoja U, Wimmelbacher M, Greiner E, Ustün S, Melzer M, Petersen K, Lein W, and

Börnke F (2010) Plastidial thioredoxin z interacts with two fructokinase-like proteins in a thiol-

dependent manner: evidence for an essential role in chloroplast development in Arabidopsis and 565

Nicotiana benthamiana. Plant Cell 22: 1498–1515

Boles MK, Wilkinson BM, Wilming LG, Liu B, Probst FJ, Harrow J, Grafham D, Hentges

KE, Woodward LP, Maxwell A, Mitchell K, Risley MD, Johnson R, Hirschi K, Lupski JR,

Funato Y, Miki H, Marin-Garcia P, Matthews L, Coffey AJ, Parker A, Hubbard TJ, Rogers J, 570 Bradley A, Adams DJ, and Justice MJ. (2009) Discovery of candidate disease genes in ENU-

induced mouse mutants by large-scale sequencing, including a splice-site mutation in

nucleoredoxin. PLoS Genet. 5:e1000759.

Bréhélin C, Mouaheb N, Verdoucq L, Lancelin JM, and Meyer Y. (2000) Characterization of 575

determinants for the specificity of Arabidopsis thioredoxins h in yeast complementation. J Biol

Chem. 275:31641-7.

Broin M, Cuine S, Eymery F, and Rey P (2002) The plastidic 2- cysteine peroxiredoxin is a target

at Belgorod State U

niversity on Novem



ownloaded from



for a thioredoxin involved in the protection of the photosynthetic apparatus against oxidative 580

damage. Plant Cell 14: 1417–1432.

Chen J, Deng F, Li J, and Wang QJ (2008) Selective binding of phorbol esters and diacylglycerol

by individual C1 domains of the PKD family. Biochem J. 411: 333-342.

585

Chibani K, Wingsle G, Jacquot J-P, Gelhaye E, and Rouhier N. (2009) Comparative genomic

study of the thioredoxin family in photosynthetic organisms with emphasis on Populus trichocarpa.

Mol Plant 2:308–322.

Chibani K, Tarrago L, Gualberto JM, Wingsle G, Rey P, Jacquot JP, and Rouhier N. (2012) 590

Atypical thioredoxins in poplar: the glutathione-dependent thioredoxin-like 2.1 supports the activity

of target enzymes possessing a single redox active cysteine. Plant Physiol. 159:592-605.

Dyson HJ, Jeng MF, Tennant LL, Slaby I, Lindell M, Cui DS, Kuprin S, and Holmgren A (1997) Effects of buried charged groups on cysteine thiol ionization and reactivity in Escherichia 595

coli thioredoxin: structural and functional characterization of mutants of Asp 26 and Lys 57.

Biochemistry 36: 2622–2636.

Eklund H, Gleason FK, and Holmgren A (1991) Structural and functional relations among

thioredoxins of different species. Proteins 11, 13-28. 600

Fjeld CC, Birdsong WT, and Goodman RH. (2003) Differential binding of NAD+ and NADH

allows the transcriptional corepressor carboxyl-terminal binding protein to serve as a metabolic

sensor. Proc Natl Acad Sci U S A. 100:9202-7.

605

Friesner, J.D., Liu, B., Culligan, K. and Britt, A.B. (2005) Ionizing radiation-dependent gamma-

H2AX focus formation requires ataxia telangiectasia mutated and ataxia telangiectasia mutated and

Rad3-related. Mol. Biol.Cell, 16, 2566–2576.

Funato Y, Michiue T, Asashima M, and Miki H. (2006) The thioredoxin-related redox-regulating 610

protein nucleoredoxin inhibits Wnt-beta-catenin signalling through dishevelled. Nat Cell Biol. 8:

501–508.

Funato Y, and Miki H. (2007) Nucleoredoxin, a novel thioredoxin family member involved in cell

growth and differentiation. Antioxid Redox Signal. 9:1035-1057. 615

Funato Y, Terabayashi T, Sakamoto R, Okuzaki D, Ichise H, Nojima H, Yoshida N, and Miki

H. (2010a) Nucleoredoxin sustains Wnt/β-catenin signaling by retaining a pool of inactive

dishevelled protein. Curr Biol. 20:1945-52.

620

Funato Y, and Miki H. (2010b) Redox regulation of Wnt signalling via nucleoredoxin. Free Radic

Res. 44:379-88.

Gelhaye E, Rouhier N, and Jacquot JP. (2003) Evidence for a subgroup of thioredoxin h that

requires GSH/Grx for its reduction. FEBS Lett 555:443–448. 625

at Belgorod State U

niversity on Novem



ownloaded from



Gelhaye E, Rouhier N, Gérard J, Jolivet Y, Gualberto J, Navrot N, Ohlsson PI, Wingsle G,

Hirasawa M, Knaff DB, et al. (2004) A specific form of thioredoxin h occurs in plant

mitochondria and regulates the alternative oxidase. Proc Natl Acad Sci USA 101: 14545–14550.

630

Hayashi T, Funato Y, Terabayashi T, Morinaka A, Sakamoto R, Ichise H, Fukuda H, Yoshida

N, and Miki H. (2010) Nucleoredoxin negatively regulates Toll-like receptor 4 signaling via

recruitment of flightless-I to myeloid differentiation primary response gene. J Biol Chem.

285:18586-93.

635

Hirota K, Matsui M, Murata M, Takashima Y, Cheng FS, Itoh T, Fukuda K, and Yodoi J.

(2000) Nucleoredoxin, glutaredoxin, and thioredoxin differentially regulate NF-kappaB, AP-1, and

CREB activation in HEK293 cells. Biochem Biophys Res Commun. 274:177-182.

Holmgren A (1985) Thioredoxin. Annu Rev Biochem 54, 237-271 640

Holmgren A (1989) Thioredoxin and glutaredoxin systems. J Biol Chem 264, 13963–13966.

Hung YP, Albeck JG, Tantama M, and Yellen G. (2011) Imaging cytosolic NADH-NAD(+) redox

state with a genetically encoded fluorescent biosensor. Cell Metab. 14:545-54. 645

Jacquot, J. P., Rivera-Madrid, R., Marinho, P., Kollarova, M., Le Marechal, P., Miginiac-

Maslow, M., and Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase. cDNA

characterization and expression of the recombinant protein in Escherichia coli. J Mol Biol 235,

1357-1363. 650

Kurooka H, Kato K, Minoguchi S, Takahashi Y, Ikeda J, Habu S, Osawa N, Buchberg AM,

Moriwaki K, Shisa H, and Honjo T. (1997) Cloning and characterization of the nucleoredoxin

gene that encodes a novel nuclear protein related to thioredoxin. Genomics 39:331-339.

655

Koh CS, Navrot N, Didierjean C, Rouhier N, Hirasawa M, Knaff DB, Wingsle G, Samian R,

Jacquot JP, Corbier C, and Gelhaye E. (2008) An atypical catalytic mechanism involving three

cysteines of thioredoxin. J Biol Chem 283:23062– 23072.

Laloi C, Rayapuram N, Chartier Y, Grienenberger JM, Bonnard G, and Meyer Y (2001) 660

Identification and characterization of a mitochondrial thioredoxin system in plants. Proc Natl Acad

Sci USA 98: 14144–14149

Laloi, C., Mestres-Ortega, D., Marco, Y., Meyer, Y., and Reichheld, J.P. (2004). The

Arabidopsis cytosolic thioredoxin h5 gene induction by oxidative stress and its W-box-mediated 665

response to pathogen elicitor. Plant Physiol. 134: 1006–1016.

Laughner BJ, Sehnke PC, and Ferl RJ. (1998) A novel nuclear member of the thioredoxin

superfamily. Plant Physiol 118: 987–996.

670 Lemaire SD, Michelet L, Zaffagnini M, Massot V, and Issakidis-Bourguet E. (2007)

Thioredoxins in chloroplasts. Curr Genet 51: 343–365.

Liu, B., Marc, J., Joshi, H.C. and Palevitz, B.A. (1993) A gamma-tubulin-related protein

at Belgorod State U

niversity on Novem



ownloaded from



associated with the microtubule arrays of higher plants in a cell cycle-dependent manner. J. Cell Sci. 675

104, 1217–1228.

Marty L, Siala W, Schwarzländer M, Fricker MD, Wirtz M, Sweetlove LJ, Meyer Y, Meyer

AJ, Reichheld JP, and Hell R (2009) The NADPH-dependent thioredoxin system constitutes a

functional backup for cytosolic glutathione reductase in Arabidopsis. Proc Natl Acad Sci USA 680

106:9109–9114.

Meng L, Wong JH, Feldman LJ, Lemaux PG, and Buchanan BB (2010) A membrane-associated

thioredoxin required for plant growth moves from cell to cell, suggestive of a role in intercellular

communication. Proc Natl Acad Sci USA 107: 3900–3905. 685

Meyer Y, Siala W, Bashandy T, Riondet C, Vignols F, and Reichheld JP (2008) Thioredoxins

and Glutaredoxins in Plants. BBA-Molecular Cell Research 1783:589-600.

Meyer Y, Buchanan BB, Vignols F, and Reichheld JP (2009) Thioredoxins and glutaredoxins: 690

unifying elements in redox biology. Annu Rev Genet 43:335–367.

Meyer Y, Belin C, Delorme-Hinoux V, Reichheld JP, and Riondet C (2012) Thioredoxin and

glutaredoxin systems in plants: molecular mechanisms, crosstalks, and functional significance.

Antioxid Redox Signal. 17:1124-60. 695

Minet M, Dufour ME, and Lacroute F. (1992) Complementation of Saccharomyces cerevisiae

auxotrophic mutants by Arabidopsis thaliana cDNAs. Plant J. 2:417–422.

Muller EG (1991) Thioredoxin deficiency in yeast pr olongs S phase and shortens the G1 interval 700

of the cell cycle. J Biol Chem 266: 9194–9202.

Müller L, Funato Y, Miki H, and Zimmermann R. (2011) An interaction between human Sec63

and nucleoredoxin may provide the missing link between the SEC63 gene and polycystic liver

disease. FEBS Lett. 585:596-600. 705

Perez-Ruiz JM, Spınola MC, Kirchsteiger K, Moreno J, Sahrawy M, and Cejudo FJ. (2006)

Rice NTRC is a high-efficiency redox system for chloroplast protection against oxidative damage.

Plant Cell 9:2356–2368.

710

Pontvianne F, Abou-Ellail M, Douet J, Comella P, Matia I, Chandrasekhara C, Debures A,

Blevins T, Cooke R, Medina FJ, Tourmente S, Pikaard CS, and Sáez-Vásquez J. (2010)

Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in

Arabidopsis thaliana. PLoS Genet. 6:e1001225.

715

Pulido P, Cazalis R, and Cejudo FJ. (2009) An antioxidant redox system in the nucleus of wheat

seed cells suffering oxidative stress. Plant J. 57:132-145.

Qin Y, Leydon AR, Manziello A, Pandey R, Mount D, Denic S, Vasic B, Johnson MA, and

Palanivelu R. (2009) Penetration of the stigma and style elicits a novel transcriptome in pollen 720

tubes, pointing to genes critical for growth in a pistil. PLoS Genet 8: e1000621, 2009.

at Belgorod State U

niversity on Novem



ownloaded from



Reichheld JP, Meyer E, Khafif M, Bonnard G, and Meyer Y. (2005) AtNTRB is the major

mitochondrial thioredoxin reductase in Arabidopsis thaliana. FEBS Lett. 579:337–342.

725

Reichheld JP, Khafif M, Riondet C, Droux M, Bonnard G, and Meyer Y. (2007). Inactivation of

thioredoxin reductases reveals a complex interplay between thioredoxin and glutathione pathways

in Arabidopsis development. Plant Cell 19:1851–1865.

Reichheld JP, Riondet C., Delorme V, Vignols F, and Meyer Y. (2010) Thioredoxins and 730

glutaredoxins in development. Plant Science, 178, 420–423.

Ren G, Stephan D, Xu Z, Zheng Y, Tang D, Harrison RS, Kurz M, Jarrott R, Shouldice SR,

Hiniker A, et al. (2009) Properties of the thioredoxin fold superfamily are modulated by a single

amino acid residue. J Biol Chem 284: 10150–10159 735

Riondet C, Desouris JP, Guilleminot Montoya J, Chartier Y, Meyer Y, and Reichheld JP. Glutaredoxin C1: a dicotyledon-specific glutaredoxin with a dimer dependent redox regulation.

Plant Cell Environ 35: 360–73, 2012.

740

Rivera-Madrid R, Mestres D, Marinho P, Jacquot JP, Decottignies P, Miginiac-Maslow M,

and Meyer Y. (1995) Evidence for five divergent thioredoxin h sequences in Arabidopsis thaliana.

Proc Natl Acad Sci USA 92: 5620– 5624.

Roos G, Garcia-Pino A, Van Belle K, Brosens E, Wahni K, Vandenbussche G, Wyns L, Loris R, 745 and Messens J (2007) The conserved active site proline determines the reducing power of

Staphylococcus aureus thioredoxin. J Mol Biol 368: 800–811.

Roos G, Geerlings P, and Messens J. (2010) The conserved active site tryptophan of thioredoxin

has no effect on its redox properties. Protein Sci 19:190-4. 750

Rouhier N, Lemaire SD, and Jacquot J-P (2008) The role of glutathione in photosynthetic

organisms: emerging functions for glutaredoxins and glutathionylation. Annu Rev Plant Biol 59:

143–166.

755

Sahrawy M, Hecht V, Lopez-Jaramillo J, Chueca A, Chartier Y, and Meyer Y. (1996) Intron

position as an evolutionary marker of thioredoxins and thioredoxin domains. J Mol Evol 42:422–

431.

Serrato AJ, and Cejudo FJ. (2003) Type-h thioredoxins accumulate in the nucleus of developing 760

wheat seed tissues suffering oxidative stress. Planta. 217:392-9.

Serrato AJ, Perez-Ruiz JM, Spınola MC, and Cejudo FJ. (2004) A novel NADPH thioredoxin

reductase, localized in the chloroplast, which deficiency causes hypersensitivity to abiotic stress in

Arabidopsis thaliana. J Biol Chem 279:43821– 43827. 765

Serrato AJ, Guilleminot J, Meyer Y, and Vignols F. (2008) AtCXXS: atypical members of the

Arabidopsis thaliana thioredoxin h family with a remarkably high disulfide isomerase activity.

Physiol Plant 133: 611–622.

770

Setya A, Murillo M, and Leustek T. (1996) Sulfate reduction in higher plants: molecular evidence

for a novel 5'-adenylylsulfate reductase. Proc Natl Acad Sci U S A 93: 13383– 13388.

at Belgorod State U

niversity on Novem



ownloaded from



Traverso JA, Micalella C, Martinez A, Brown SC, Satiat-Jeunemaître B, Meinnel T, and

Giglione C. (2013) Roles of N-terminal fatty acid acylations in membrane compartment 775

partitioning: Arabidopsis h-type thioredoxins as a case study. Plant Cell. 25:1056-77.

Vieira Dos Santos C, and Rey P (2006) Plant thioredoxins are key actors in the oxidative stress

response. Trends Plant Sci 11: 329–334 .

780

Vignols F, Mouaheb N, Thomas D, and Meyer Y (2003) Redox control of Hsp70-Co-chaperone

interaction revealed by expression of a thioredoxin-like Arabidopsis protein. J Biol Chem 278:

4516–4523.

Xue LJ, Guo W, Yuan Y, Anino EO, Nyamdari B, Wilson MC, Frost CJ, Chen HY, Babst BA, 785 Harding SA, and Tsai CJ. (2013) Constitutively elevated salicylic Acid levels alter photosynthesis

and oxidative state but not growth in transgenic populus. Plant Cell. 25:2714-30.

Zhang G, Kazanietz MG, Blumberg, PM, and Hurley JH (1995) Crystal structure of the cys2

activator-binding domain of protein kinase Cd in complex with phorbol ester. Cell 81: 917–924 790

Zhang Q, Piston DW, and Goodman RH. (2002) Regulation of corepressor function by nuclear

NADH. Science 295:1895-7.

795

at Belgorod State U

niversity on Novem



ownloaded from



Figure legends

Figure 1: Phylogenetic tree of NRX

The accession numbers are as follows: AaNRX1, EGB06803; ApNRX, XP_001947195; AsNRX,

ADY43508; AeNRX, EGI65199; AlNRX1, AFH64402; AlNRX2, EFH43567; AtNRX1, 800

AEE33684; AtNRX2, AEE85880; BsNRX1, ACI16008; BtNRX, NP_001095606; CgNRX,

EGV96743; CmNRX1, AAU04767; CrNRX1a, XP_001701995; CrNRX1b, XP_001701806;

CrNRX2, XP_001701801; CrNRX3, EDO99555; EcNRX, XP_001502218; EsNRX1a, CBN76885;

EsNRX1b, CBN79184; DrNRX, NP_001018431; HgNRX, EHB13353; HsNRX, NP_071908;

MdNRX, XP_001364571; MmNRX, NP_032776; MnNRX1, XP_002504076; MtNRX1, 805

ACJ85567; MtNRX2, XP_003603818; MtNRX3, XP_003603563; NveNRX, XP_001634149;

NviNRX, XP_001607483; QsNRX1, AAS02080; OsNRX1a, NP_001050329; OsNRX1b,

AAU89249; OsNRX1c, EEC75442; OsNRX1d, NP_001050331; OsNRX2, NP_001044503;

OsNRX3, EEC77960; PhtNRX1, XP_002183102; PsNRX1, ABK25413; PsNRX2-3, ABK25089;

PtNRX1a, XP_002314537; PtNRX1b, XP_002314534; PtNRX1c, XP_002314533; PtNRX1d, 810

EEF00707; PtNRX1e, XP_002314535; PtNRX2, XP_002306954; PtNRX3, XP_002330779;

RcNRX1, XP_002525368; RcNRX2, XP_002510593; RtNRX, NP_001101755; SbNRX1,

XP_002467709; SbNRX2, XP_002467708; SbNRX3, XP_002448495; SmNRX1, EFJ30324;

SsNRX, NP_001167329; TgNRX1a, EEE25737; TgNRX1b, EEE24650; TsNRX1, EFV57630;

VcNRX1, EFJ40226; VvNRX1a, XP_002263480; VvNRX1b, CBI28536; VvNRX1c, 815

XP_002262828; VvNRX1d, XP_002262857; VvNRX1e, XP_002264954; VvNRX2,

XP_002285895; VvNRX3, CBI20806; XlNRX, NP_001086161; ZmNRX1a, NP_001105407;

ZmNRX1b, NP_001130856; ZmNRX2, NP_001131397.

Aa: Aureococcus anophagefferens, Ap: Acyrthosiphon pisum, As: Ascaris suum, Ae: Acromyrmex

echinatior, Al: Arabidopisis lyrata, At: Arabidopsis thaliana, Bs: Bodo saltans, Bt: Bos taurus, Cg: 820

Cricetulus griseus, Cm: Cucumis melo, Cr: Chlamydomonas reinhardtii, Dr: Danio rerio, Ec:

at Belgorod State U

niversity on Novem



ownloaded from



Equus caballus, Es: Ectocarpus siliculosus, Hg: Heterocephalus glaber, Hs: Homo sapiens, Md:

Monodelphis domestica, Mm: Mus musculus, Mn: Micromonas sp. RCC299, Mt: Medicago

truncatula, Nve: Nematostella vectensis, Nvi: Nasonia vitripennis, Os: Oryza sativa, Pht:

Phaeodactylum tricornutum CCAP 1055/1, Ps: Picea sitchensis, Pt: Populus trichocarpa, Qs: 825

Quersus suber, Rc: Ricinus communis, Rn: Rattus norvegicus, Sb: Sorghum bicolor, Sm:

Selaginella moellendorffii, Ss: Salmo salar, Tg: Toxoplasma gondii, Ts: Trichinella spiralis, Vc:

Volvox carteri f. nagariensis, Vv: Vitis vinifera, Xl: Xenopus laevis, Zm: Zea mais.

Figure 2: Comparative domain organization of different types of NRX. 830

TRX domains are represented by shaded grey boxes and undefined domains as white boxes. CTD,

Cysteine-rich C-terminal domain. PDI b', PDI-like C-terminal domain. Canonical TRX active sites

are represented as black bars. Atypical TRX-like active sites are shown as grey bars.

Figure 3: Activity of NRX determined by the insulin-disulfide reduction assay. 835

A. Purification of the recombinant (His)6-NRX. 1 µg of NRX1, NRX1-Cterm and NRX2 was

loaded onto an SDS-PAGE gel. M: molecular weight marker.

B. Insulin-disulfide reduction of the recombinant NRX1 (circles), NRX1-Cterm (crosses), NRX2

(triangles) and TRXh3 (squares) was measured at pH 7.0 and 20°C. 1 µM of each enzyme was used

in the presence of 1 mM DTT and 0.13 mM insulin. The baseline of insulin reduction by DTT was 840

used as a control (black line). The timecourse of insulin precipitation was measured at 650 nm.

Figure 4: Reduction of NRX1 by NTRA

A. Reduction activity of NRX by NTR determined by the insulin-disulfide reduction assay. The

activity was assayed with 10 µM FAD, 0.5 mM NADPH, different concentrations of NRX1 845

proteins, and 1 µM of AtNTRA. The consumption of NADPH was followed spectrophotometrically

at 340 nm at 20°C during 15 min and the initial rate of consumption was used to measure the

at Belgorod State U

niversity on Novem



ownloaded from



activity.

B. Km determination NTRA for NRX1 at pH 7.0 and 20°C.

850

Figure 5: Complementation of the budding yeast trx1trx2 mutant by NRX.

AtNRX1 is able to partially complement the H2O2 tolerance of the trx1trx2 mutant. Cells expressing

AtNRX1, AtNRX2, yTRX1 and yTRX2 from the pGK1 promoter of the pFL61 high-copy number

expression vector were grown to a density of 107 cells per ml and plated on YNB agar medium at

the indicated OD600nm in the presence or absence of methionine (-Met, +Met) or in the presence of 855

methionine sulfoxide (+MetO) as sole source of sulfur. Cells were also plated on YNB agar medium

containing H2O2 at various concentrations. Plates were incubated 4 days at 28 °C. Several

independent transformed yeast clones were tested with very similar complementation profiles.

Figure 6: Cytosolic and nuclear subcellular localization of NRX and NTR. 860

A, B and C, whole mount root tip immunolocalization of NRX1. A, DAPI staining in blue ; B, Anti-

NRX1 Ab in yellow ; C, Merge

D, E, F, G, H squashed root tip immunolocalization of NRX1

D, DAPI staining in blue ; E, Anti-NRX1 Ab in yellow ; F, Merge ; the red arrow indicates where

the intensities were measured for both channels DAPI and Alexa (cf graph in I). 865

G, H are controls without the anti-NRX1 primary antibody ; G, DAPI staining in blue ; H, Alexa

secondary antibody only in yellow

I, This graph gives the intensity according to the distance ( m) along the arrow displayed in F for

both DAPI and Alexa channels. NRX1 is present in the cytoplasm and the nucleus but exluded from

the nucleolus. 870

J, K and L, crop images of a whole mount root tip immunolocalization of NTR. J, DAPI staining in

blue ; K, Anti-NTR Ab in yellow ; L, Merge. Contrary to NRX1, NTR is more abundant in the

cytoplasm than in the nucleus. NTR is also excluded from the nucleolus.

at Belgorod State U

niversity on Novem



ownloaded from



M, Detection of NRX1 and NTR proteins in subcellular cytosolic (C) and nuclear (N) extracts of

Arabidopsis flower buds. Immunodetections of cytosolic thioredoxins TRXh3 and TRXh5, and 875

nuclear nucleolin Nuc1 were used to evaluate the purity of the subcellular fractions.

Bar is 2 m for A-F and 7 m for G-H, J-L.

Figure 7: Dimerization of the AtNRX1 protein.

A. Gel filtration chromatographic analysis of crude protein extracts from flower buds separated 880

under 0.5 M KCl buffer conditions. AtNRX1 protein was detected by western-blot. Numbered lines

correspond to the protein fractions (from 49 to 79). The peak position of alcohol dehydrogenase

(ADH, 158 kDa) and bovine serum albumin (BSA, 67 kDa) markers are indicated by black arrows.

The white arrow at the fraction 65 indicates the estimated size of the AtNRX1 protein peak. Crude:

crude protein extract (5 µl) before gel filtration. 885

B. Gel filtration chromatographic analysis of the recombinant AtNRX1 protein. The peak position

of coalbumine (75 kDa) and -amylase (200 kDa) markers are indicated by dashed lines. 5 µl of

each of fractions 20 to 34 was analysed under reducing conditions by western-blot using the anti-

NRX1 antibody.

890

Figure 8: Affected pollen fertility in nrx1 mutants.

A. Segregation analysis of nrx1-401, nrx1-340 and nrx2-735 mutant alleles. % progeny, percentage

of plants in the progeny having the given nrx1 mutant genotype (Wt, wild-type, Ht, heterozygous,

Ho, homozygous). n, number of progeny analysed by PCR. P values < 0.005 (*) and < 0.001 (**)

were considered to be statistically significant. NS, P values > 0.05 were considered to be non 895

significant

B. Reciprocal cross between NRX1/nrx1-401 and Col-0. Kan, Number of plants being resistant (R)

or sensitive (S) to kanamycine. %, percent of R or S plants. n, number of plants analysed. P values

<0.005 (*) were considered to be statistically significant. NS, P values > 0.05 were considered to be

at Belgorod State U

niversity on Novem



ownloaded from



non significant. 900

C. NRX expression in pollen. Semi-quantitative RT-PCR was done on RNA extracted from mature

pollen and mature flowers for 30, 35, and 40 cycles. SPIK was used as a pollen specific control

gene. Note that a high level of SPIK cDNA is also present in mature flowers. EF1 is used as a

constitutive marker gene.

905

Supplemental figure 1: Alignement of type I, II and III NRX from several angiosperms.

The positions of introns is indicated as blue bars. The putative TRX-like active sites are indicated in

red. The conserved Cysteine-rich sequences in C-terminal domain are indicated in yellow. TRX

specific conserved amino-acids are also indicated.

910

Supplemental figure 2: Expression of NRX1 and NRX2 genes.

(A) Steady state levels of NTRA and NTRB mRNAs in different plant organs. Semiquantitative RT-

PCR was performed using gene-specific (NTRA and NTRB) and reference gene (EF1) primers.

Twenty-seven PCR cycles were used to amplify EF1 cDNAs. Thirty PCR cycles were used to

amplify NRX1 and NRX2 cDNAs. 915

(B) NRX1 protein detection in different plant organs. Protein gel blots of crude protein extracts (20

µg) were probed with antibodies directed against NRX1. F, flowers; B, flower buds; S, stems; L,

rosette leaves; R, roots.

Supplemental figure 3: Characterization of nrx1 and nrx2 mutants 920

A. AtNRX1 and AtNRX2 gene structure. The T-DNA (SALK113401, SALK132340 and

SALK021735) insertions are indicated. Primers used to amplify respective PCR fragments are

indicated.

B. RT-PCR analysis of the NRX1 and NRX2 mRNAs in the nrx1 and nrx2 homozygote mutants.

Primers 1-2 and 3-4 were used to amplify cDNA fragments in the nrx1-401 and nrx1-340 mutants, 925

at Belgorod State U

niversity on Novem



ownloaded from



respectively. Primers 1-2 were used to amplify cDNA fragments in the nrx2-735 mutants. As a

control, Actin2 mRNAs were detected. Two independent plants were analysed for each mutant line.

C. Immunodetection of NRX1 in flower buds of Col-0, nrx1 and nrx2 homozygote mutants using

anti-NRX1 antibodies.

930

Supplemental figure 4: Nuclear and cytosolic localization of NRX1:GFP, NRX2:GFP and

NTRA:GFP fusion proteins

Localization of the NRX1:GFP (A), NRX2:GFP (C) and NTRA:GFP (D) fusion proteins in

infiltrated tobacco leaves (A, B) or stably transformed 5-days old BY-2 cells (C-E). The localization

of the GFP (B, E) protein was used as a control. Arrowheads indicate nuclei. 935

Supplemental figure 5: Redox-independent dimerization of NRX1

Crude protein extracts from flower buds were extracted and further treated with different

concentrations of DTT. Samples (20 µg) were analyzed by SDS–PAGE and western blot with anti-

NRX1 antibodies. In order to avoid diffusion of DTT within the gel, and reduction of a putative 940

redox-dependent dimer in the sample untreated with DTT (DTT 0 mM), this sample was run on a

separate gel. The arrow indicates the position of the NRX1 monomer according to standard

molecular weight markers.

Supplemental figure 6: Phenotype of nrx1, nrx2 and nrx1 nrx2 mutants 945

A. Eight-day-old Col-0, nrx1-401, nrx1-340, nrx2-735 and nrx1 nrx2 mutants grown in vitro.

B. Eighteen-day-old Col-0 and nrx1-401 plants grown on soil. Other nrx mutants show a similar

phenotype.

950

at Belgorod State U

niversity on Novem



ownloaded from



Supplemental Table 1: List of primers

Cloning:

NRX1gate-atg: GGAGATAGAACCATGGCCGAAACCTCGAAGCAAGTCAACG

NRX1gate-stop: CAAGAAAGCTGGGTCTCAGGCCTTGGTGCATACGTTTCCTTC 955

NRX1- CTDgate-stop: CAAGAAAGCTGGGTCTCAATCTTTTGCTATCTCATCGTAC

NRX2-Nde1: GCCATATGGCAGTATCAGCTGATTACCAAG

NRX2-BamH1: GCGGATCCCTAAACCAATAATGCTTCTTCTTCT

NRX1-Not53: TGCGGCCGCATGGCCGAAACCTCGAAGCAAGTC

NRX1-Not35: TGCGGCCGCTCAGGCCTTGGTGCATACGTTTCC 960

NRX2-Not53: TGCGGCCGCATGGCAGTATCAGCTGATTACCAA

NRX2-Not35: TGCGGCCGCCTAAACCAATAATGCTTCTTCTTCT

Genotyping, RT-PCR:

NRX1-1: GCCATATGATGGCCGAAACCTCGAAGCAAGTC

NRX1-2: CGAATCAGTAAACGGAACAGCGAGCC 965

NRX1-3: ATTGTGTTGATATCTCTTGA

NRX1-4: GCGGATCCTCAGGCCTTGGTGCATACGTTTC

NRX2-1: GTTGTACTTTGGTGCACACT

NRX2-2: GCGGATCCCTAAACCAATAATGCTTCTTCTTCT

ACT2-53: GTTAGCAACTGGGATGATATGG 970

ACT2-35: AGCACCAATCGTGATGACTTGCCC

SPIK-53: GTATAGCAGTGAGCCTACAATG

SPIK-35: TCATTACTCA AAATCGA AAGAG

EF1-53: CTAAGGATGGTCAGACCCG

EF1-35: CTTCAGGTATGAAGACACCAEE28216 975

at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



at Belgorod State U

niversity on Novem



ownloaded from



Documents

NTR/NRX Define a New Thioredoxin System in the Nucleus of Arabidopsis thaliana Cells