Protein purification, gene cloning and sequencing of an acidic endoprotease from Myxococcus xanthus DK101

Eur. J. Biochem. 222, 247-254 (1994) 0 FEBS 1994

Protein purification, gene cloning and sequencing of an acidic endoprotease from Myxococcus xanthus DKlO1 Nathalie LUCAS ’, Catherine MAZAUD-AUJARD’, Laure BREMAUD’, Yves CENATIEMPO’ and Raymond JULIEN’ ’ Institut de Biotechnologie, Facult6 des Sciences, Limoges, France

Institut de Biologie Moltculaire et d’IngCnierie Gtnttique, URA CNRS 1172, Universitt de Poitiers, France

(Received January l4March 11, 1994) - EJB 94 0042/2

An acidic endoprotease (MAEP) secreted during vegetative growth by Myxococcus xanthus DKlOl was purified to homogeneity by a series of chromatographic procedures. The endoprotease cleaved the Phe-Met bond of Ic-casein under acidic conditions (pH 5.9). Its apparent molecular mass and its isoelectric point have been estimated to be 12 kDa and 4.5, respectively. From the N-terminal amino acid sequence, a set of two primers for polymerase chain reaction have been designed. Amplification of the corresponding DNA fragment (84 bp) generated a probe, then used to screen an expression DNA library of M. xanthus and to isolate a recombinant plasmid which contained a 2127-bp insert. The nucleotide sequence included an open reading frame (OW) of 585 nucleotides, encoding 195 amino acids, that exhibited a high degree of similarity with the N-terminal amino acid sequence of the purified MAEP. The polypeptide sequence inferred from this O W revealed that the mature enzyme should contain 131 amino acids arising from a 195-amino-acid precursor protein.

Myxococcus xanthus, a Gram-negative bacterium living in soil, has been studied mainly as a prokaryote model for multicellular morphogenesis [l, 21. This organism shows two striking features. First, cells migrate by gliding motility on a semi-solid surface [3] and, upon starvation of nutrients, they undergo a spectacular development cycle [4]. Second, it is able to hydrolyze macromolecules, including bacterial cell walls, with various extracellular enzymes.

Several species of myxobacteria have been found to secrete various bacteriolytic enzymes, among them several proteases, during vegetative growth, allowing them to feed on other bacteria. Some of their extracellular proteases have been isolated and characterized. Two bacteriolytic proteases, displaying the same molecular mass (19 kDa) have been obtained from the culture supernatant of a Sorangium species [5] . The first, termed a-lytic protease, was very active on casein and also exhibited a peptidase and amidase activity. The second, named p-lytic enzyme, less active on proteins, showed a stronger peptidase and amidase activity than the former. Myxobacter AL-1 proteases also displayed both proteolytic and bacteriolytic activities. Two smaller extracellular

Correspondence to R. Julien, Institut de Biotechnologie, 123 Av-

Fax: +33 55 45 76 53. Abbreviations. X-gal, 5-bromo-4-chloro-indolyl-~-~-galacto-

side ; IPTG, isopropyl thio$-D-galactoside ; BCIP, 5-bromo-4- chloro-3-indoyl phosphate; NBT, nitro blue tetrazolium chloride; ORF, open reading frame ; MAEP, Myxococcus acidic endoprotease; Mcp, milk-clotting proteolytic activity ; MAPl, Myxococcus alkaline protease 1 ; SAEP, Stigmatella acidic endoprotease ; Ic-casein, kappa- casein; LB, Luria-Bertani; Amp, ampicillin.

Enzymes. Chymosin (EC 3.4.23.4.), restriction endonucleases (EC 3.1.21.4).

Note. The novel nucleotide sequence mentioned in the text has been deposited with the GenBankEMBL Data Bank and is available under accession number X75892.

enue Albert Thomas, F-87060 Limoges Cedex, France

enzymes, named protease I and protease I1 (8.7 kDa and 17 kDa), have been isolated from Myxobacter AL-1 [6, 71. The second showed a unique specificity towards lysine resi- dues under alkaline pH conditions. Gnosspelius [8] has purified an extracellular protease (26 kDa) from Myxococcus virescens. The main targets of the enzyme were identified as peptide bonds involving amino acids with nonpolar side chains. This protease exhibits an alkaline optimal pH and be- longs to the serine protease family. Recently, an extracellular protease with an elastolytic activity (MAP1) has been purified from M . xanthus DKlOl [9]. The enzyme is composed of a single peptide chain with a molecular mass of 40 kDa, a pHi of 5 and was classified as a metalloprotease. Finally, an acidic endoprotease from Stigmatella uuruntiaca DW4 (called SAEP) has been purified during vegetative growth [lo]. This protease has been characterized by an apparent molecular mass of 30 kDa, a pHi of 4.2 and an acidic optimal pH of 5.9.

Different functions may be ascribed to myxobacterial extracellular proteases. First, they most likely play a nutritional role because myxobacteria use proteins as both carbon and energy sources. Second, proteases are involved in other pro- cesses under starvation. Under these circumstances, bacterial cells aggregate to form fruiting bodies within which some of them are converted into resistant spores. Recently Plamann et al. [ l l ] have shown that a proteolytic activity was associated with A factor. Two proteases (27 kDa and 10 kDa) have been identified as heat-labile A factor and found to play a role in the developmental process of M. xanthus. A highly specific protease activity was found for substrates with an arginine or lysine at the cleavage site, suggesting that the 27- kDa protease is a trypsin-like enzyme [l l] .

In a previous article, a chymosin-like extracellular acidic endoprotease secreted by strain DK101, has been characterized by its capacity to hydrolyze the Phe-Met bond in IC-

248

casein [ 121. We describe here, the purification procedure used to obtain the first homogeneous acidic endoprotease secreted by M. xunthus DK101. This protease, termed Myxo- coccus acidic endoprotease (MAEP), was found to hydrolyze the Phe-Met bond of Ic-casein under acidic conditions, this event triggering coagulation. In a second part, we report the cloning of the MAEP gene from M. xunthus. The nucleotide and the inferred amino acid sequence are also described.

MATERIALS AND METHODS Bacterial strains, media and culture conditions

The organism used was Myxococcus xunthus strain DKlOl (ATCC 19368). Cells were grown (with inoculum of lo7 cells/ml) under vigorous aeration in a 1% (mass/vol) Bactocasitone (Difco Laboratories), 10 mM Tris/HCl, pH 8.0, 1 mM KH2P04, pH 7.7, 8 mM MgSO,; the final pH of the mixture (buffer A) was pH 7.6 at 30°C. Ic-casein and chymosin were from Sigma. DEAE-Trisacryl was purchased from IBF and Sephadex G75 from Pharmacia. The genomic library of M. xunthus DKlOl (constructed in an expression plasmid vector pTTQl8) and Escherichiu coli DH5amcr were kindly provided by J. Guespin-Michel (labor- atoire de Microbiologie, Rouen, France). E. coli JM105 and DH5amcr were used as hosts of bacteriophage M13 (mp18 and mp19) and pTTQ18, respectively. E. coli cells were rou- tinely grown in Luria-Bertani (LB) medium [13] at 37°C with vigorous shaking and supplemented, when appropriate, with ampicillin (100 pg/ml). LB was solidified with 1.5% agar (Biom6rieux).

Enzymes and chemicals X-gal (5-bromo-4-chloro-indolyl-/3-~-galactoside) and

IPTG (isopropyl thio-/3-D-galactoside) used at 0.1 mg/ml were purchased from Boehringer, Mannheim. Primers were synthesized by using a Gene Assembler Plus Synthesizer. Phage M13 was from Pharmacia. Ampicillin was purchased from Sigma Chemical Co. ; restriction enzymes, T4 DNA li- gase, T4 DNA polymerase (from Gibco BRL) were used according to the instructions of the manufacturers. T7 DNA polymerase (Sequenase) was from United States Biochemical Corp. [a-35S]dATP (1000Ci/mmol) and [a-32P]dCTP (3000 Ci/mmol) were purchased from Amersham.

Assay of lytic activity Clotting activity was estimated by determining, at

550 nm, the time required for 100 pl enzyme solution to induce optimal turbidity of a 1-ml reaction mixture containing 900 ~ 1 0 . 2 5 % (mass/vol) Ic-casein in 0.01 M potassium phosphate, pH 5.9, 0.1 M NaC1, at 30°C. One unit is the amount of enzyme that hydrolyzed 1 nmol Ic-caseinlmin.

Protein fractions were analyzed by electrophoresis using two 12.5% polyacrylamide gels. One was silver stained and the other horizontally applied to a Ic-casein-agarose gel (0.5%, madvol, Ic-casein, 0.15%, mass/vol, Pastagar (Pasteur) in 0.01 M potassium phosphate, pH 6.0, 0.1 M NaC1). Following an incubation at 30°C for 15 h, Ic-casein- agarose gel was then stained for 15 min with Coomassie blue and destained in a solution containing methanol/acetic acid/ water (3 : 1 : 6, by vol.). Hydrolyzed Ic-casein appeared as a non-stained band on a deep-blue background, allowing loca- tion of protease activity.

Purification of MAEP from M. xanthus

A 20-h old culture was centrifuged (2500 g, 15 min, 4°C) and the supernatant fluid (1 liter) was filtered through a 0.45- pm pore size filter (Millipore), dialyzed overnight at 4OC against 0.02 M piperazine/HCl, pH 5.5, and chromatographed on a DEAE-Trisacryl column (8 cmX30 cm) with a linear gradient over 0.1 -0.5 M NaCl in the same buffer. The effluent was monitored at 280 nm. The flow rate was 180 ml/ h and fractions of 40 ml were collected. Fractions showing clotting activity on Ic-casein (as previously described) were collected, lyophilized and dialyzed overnight at 4 "C against 0.01 M piperazine/HCl, pH 6.0. The solution was subjected to gel filtration on a Sephadex G-75 column (2.5 cmX75 cm) equilibrated with the dialysis buffer. A flow rate of 60ml/ h was maintained and 4 ml fractions were collected. Active fractions were pooled and dialyzed against 0.02 M piperazine/HCl, pH 5.5, then chromatographed on a DEAE-Tri- sacryl column (2.5 cmX9 cm). Proteins were eluted by a linear gradient over 0-0.3 M NaCl in the same buffer. The flow rate was 60 ml/h and fractions of 10 ml collected. The protein peak showing activity was lyophilized. The next step of purification was HPLC on a C, reverse-phase column (0.46 cmX75 cm; TSK, TM S-250; ULTROPAC, LKB, 10 pm). Elution of proteins was performed by a discontinuous gradient of acetonitrile containing 0.1 % trifluoroacetic acid at a flow rate of 3 ml/h and the effluent was followed at 220 nm. Fractions containing purified protein were collected and lyophilized.

Protein concentration was measured by the method of Lowry et al. [14] with crystalline bovine serum albumin as a standard (Nutritional Biochemicals Corp.).

Determination of the molecular mass of the purified MAEP was performed by SDS/PAGE using standard proteins of known molecular masses. A 20% polyacrylamide gel was used with an electrophoresis Phast System (Pharmacia) in the presence of 0.01 M TrisMCl, pH 8.0, 2.5% SDS and 5 % 2- mercaptoethanol. The isoelectric point of the purified MAEP was determined with the same system, and was performed at a pH ranging over 4-6.5. Protein was visualized by the silver-staining method [15].

Partial N-terminal sequence analysis of MAEP was performed on a 470A Applied Biosystems protein sequencer (CNRS, Service Central d' Analyse).

Carbohydrate analysis

Carbohydrate-containing structures were detected by probing enzyme fractions with lectins according to Hasel- beck et al. [16]. Analysis was performed with Digoxigenin detection kit (Boehringer).

Production of a gene probe by PCR Primers for the polymerase chain reaction were designed

according to the N-terminal sequence of purified MAEP. PCR was performed in a total volume of 50 p1 of a mixture containing the following: 1 pg M . xunthus chromosomal DNA, 50 pmol of each primer (1 and 2), 200 pM deoxy- nucleoside triphosphates, 1.25 U Tuq DNA polymerase and 5 p1 1OX buffer (0.1 M Tris/HCl, pH 9.0, 0.0125 M MgC12, 0.5 M KCl, 1 % Triton X-100). Amplification was for 30 cycles, and each cycle consisted of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and polymerization at 72°C for 90 s.

249

Table 1. Purification of MAEP from M. xunthus. Protein was measured according to Lowry et al. [14]. One unit is the amount of enzyme that hydrolyzed 1 nmol K-caseidmin.

Fraction Total Total activity Specific activity Recovery Purification protein ( X 10-2) ( x 10-3)

mg units Supernatant 1000 237 DEAE-Trisacryl 53 20.98 Sephadex G75 2.5 1.38 DEAE-Trisacryl 0.37 1.06

units/mg % -fold 2.37 100 1 .o 3.96 8.80 1.67 5.52 0.58 2.32

28.70 0.44 12.1

Southern-blot and hybridization M. xanthus chromosomal DNA was extracted as de-

scribed by Starich and Zissler [17]. Restriction fragments were extracted from the agarose gel by the freeze-squeeze method [18].

Several DNA digestions were run in buffer B (0.1 m Tris/ HC1, pH 8.0, 0.1 m boric acid and 0.002 m EDTA) agarose gels and the DNA was transferred from the gels to nylon filter (Hybond N', Amersham) [ 191. 32P-labeled PCR ampli- fied DNA was used to screen the gene library for overlapping clones by colony hybridization. Nylon filters obtained from Southern blots and selected colonies were hybridized with probes labelled by random priming [20]. Hybridization was performed for 12 h at 65°C. Filters were washed once with 2X NaClKit at 65°C for 15min, once with 2X NaCUCit, 0.1% SDS for 15 min and twice with 0.2X NaCUCit, 0.1% SDS for 15 min. The filters were finally exposed to a Hyper- film MP (Amersham) at - 80 "C.

DNA sequencing Specific restriction fragments of the cloned DNA were

ligated into the appropriate M13 vectors, mp18 or mp 19 [13] and sequenced by the dideoxynucleotide chain-termination method [21].

RESULTS Purification of MAEP

In preliminary experiments, the optimal pH of MAEP was determined. The clotting activity was measured over pH 5.5-pH 9 using the supernatant from a 20-h culture. The maximum clotting activity was at pH 6 with a steep decrease to pH 7.

The results of the experimental procedure leading to a purified enzyme are summarized in Table 1.

The supernatant of the culture was dialyzed, then layered onto the anion-exchange resin DEAE-Trisacryl. Clotting activity was detected in both adsorbed and non-adsorbed material. The selected fraction represented approximately 10% of the total activity applied to the column. It should be noted that this first step resulted in a rather poor yield. Several chromatographic methods have been attempted (e.g. cation exchange, adsorption, pseudo-affinity), the anion exchange giving the better result. The clotting activity was eluted over 100-200 mh4 NaCl in 20 mM piperazine/HCl, pH 5.5, from a DEAE-Trisacryl matrix. Zymogram analysis of the pooled and concentrated fractions showed only one band (data not shown). Then, the enzyme was fractionated on Sephadex G- 75. Gel filtration removed large amounts of colored impuri-

1 .o

0.5

0.0

5.4- 1.0

5.0

A

0 OD

4.6 N 9 C

4.2 0

0 0

C 0) .- 3.8

- 0.5 p a 3.4 - a Y

0.0

Elution volume (ml)

- + +

B

Fig. 1. Elution profile and molecular mass determination for pooled fractions from DEAE-Trisacryl chromatography. (A) Sephadex G75 elution profile of pooled fractions obtained after DEAE-Trisacryl. Gel filtration was performed on a 2.5 cmX75 cm column in 0.01 M piperazine/HCl, pH 6, at 60 mVh. The fraction size was 4 ml. Determination of molecular mass. Right, inner scale was log (molecular mass) ; left; calibration curve; (a) p-galactosi- dase, molecular mass = 130000; (b) bovine serum albumin, molecular mass = 67000; (c) ovalbumin, molecular mass = 43000; (d) cytochrome c, molecular mass = 12700Da; (B) The insert shows the zymogram analysis of the four fractions (numbered 1-4 in Fig. 1 A and B) containing clotting activity (see Materials and Meth- ods for details).

ties (Fig. 1 A) still present in the preparation. Four new fractions were obtained, all displaying enzymic activity. Zymo- gram analysis revealed similar patterns characterized by one band (Fig. 1B). However, the band displaying the highest anodic mobility, similar to that observed in step 1, was kept

250

o.2 1 n r lo5

A

0.0

172- 146 - 82- 63-

25-

Time (min)

- 6 5

- 5 8

- 5 2

0

65 2

45

25

5

- 45 - 4 1

Fig.2. Analysis of MAEP from M. xanthus. (A) Reverse-phase HPLC of pooled fractions obtained after DEAE-Trisacryl. Elution of proteins was performed on a column (0.46 cmX75 cm) of C, reverse-phase chromatography with a discontinuous gradient of acetonitrile, at a flow rate of 3 ml/h. (B) The insert shows SDS/ polyacrylamide gel electrophoresis and isoelectric focusing of M. xunthus MAEP. Molecular mass (ma) and isoelectric point of marker proteins are also shown.

(Fig. 1 A). The enzyme was further purified by repeating the first chromatographic step (DEAE-Trisacryl). Again, the clotting activity was eluted over 100-200 mM NaCl in 20 mM piperazine/HCl, pH 5.5, from a DEAE-Trisacryl column. The physical homogeneity of the enzyme was examined by PAGE. Under non-denaturing conditions, a single protein band was detected and zymogram analysis of the pooled and concentrated fractions showed only one active band (data not shown). However, SDS/PAGE analysis revealed that the material was heterogeneous (results not shown) and therefore reverse-phase HPLC (C, column) was used to remove impurities. MAEP, eluting at approximately 30% acetonitrile (Fig. 2A), was lyophilized before SDS/ PAGE analysis. Silver staining showed that the purified enzyme is a single protein with an apparent molecular mass of 12 kDa (Fig. 2B). A single protein band was also observed by isoelectric focusing with a pHi close to 4.5 (Fig. 2B).

Carbohydrate detection Purified MAEP obtained by separation on an SDS/

polyacrylamide gel was blotted onto nitrocellulose mem-

brane and submitted to carbohydrate detection. One band was obtained after labeling with digoxigenin, suggesting that the protein was either complexed with unknown material also forming a trail along the lane, or glycosylated (data not shown).

N-terminal sequence and construction of an oligonucleotide probe

The sequence of the first 37 N-terminal amino-acids of the MAEP was : SSXQPASEGNXIGAGYLVXTDXSAQY- EXAPKXDXRXL (X ; unidentified residue). No significant similarity to any known sequence was found in the EMBL data base using the TFasta software [22].

In order to clone the gene that encodes the 12-kDa protein, upstream and downstream primers were deduced from the N-terminal sequence at positions 4-13 and 24-31 and their nucleotide sequences established as follows :

Upstream primer (l), “Q P A S E G N X I G I 3 5’-GAATTC-CAG-CCG-GCI-TCC-GAG-GGC-AAC-111- ATC-GGC-3’.

Downstream primer (2), 31K P A X E Y Q A *“ 5’-CCTAGG-CTT-IGG-IGC-III-CTC-GTA-CTG-GGC-3’.

Oligonucleotides were chosen according to codon usage in M. xunthus [23]. Inosine was used for unidentified codons or for the third base, to take into account the degeneracy of the genetic code. The primers contain a EcoRI and BamHI site, respectively appended at the 5’ end to facilitate cloning of the PCR products.

After 30 cycles, using M. xunthus chromosomal DNA as a template, a major band of approximately 100 bp was ampli- fied (result not shown). This band was extracted from the gel, digested by EcoRI and BurnHI and ligated into M13mp18 EcoRI-BurnHI sites. The ligation mixture was used to transform E. coli JM105, then screened with the ?’P- labeled PCR fragment. Several transformants were characterized and two of them sequenced. The sequence of their insert was identical. It consists of 84 bp (excluding the EcoRI and BamHI sites). The 75% G+C content of the DNA fragment is typical of myxobacteria [23]. The 84-bp fragment was then used as a probe for Southern hybridization of M. xunthus chromosomal DNA digested with several restriction enzymes (such as BglI, EcoRI, NcoI, and SucI). In every digest, one fragment was found to hybridize the probe, suggesting the presence of only one gene in M. xanthus (result not shown).

Cloning of the MAEP gene

To obtain the MAEP gene, the 84-bp fragment was used to probe a M . xunthus genomic library constructed in the expression vector pTTQ18. Subsequent transformants were screened by colony hybridization using the labelled probe. Out of lo4 tested colonies, only one gave a very strong posi- tive reaction and was further characterized. A 2.1 kb SalT- SalI M . xunthus fragment was isolated, then extracted from agarose gel and purified. To generate smaller DNA segments for sequencing, the 2.1 kb, fragment was digested with RsaI. The resulting fragments were blunt ended by T4 DNA polymerase and subcloned into the SmaI sites of M13mp18 and

25 1

317 GTACTGAGCTTCAGCCTCGG AGCTGCTGCGTGTCGTAGGT GGCCGACGGGTAGTGTCGCT GGATTTGGTCTGGCAGTCTC GACGCTGACACTCGTGGCCT

417 GCATGTGCATGAAGGTCGCTCACTGTCGGATATCCGTATG CGGCTCCTCTGTGCACCGCT GCGACTGTGCGAGCCTCCGT AGGGCGTCGATGTCAGCTGT

5 17 CGATACCGATGCCGGTGTCA GCTTAGCATCTCGTGTGTCA TGCTGCTTCGGTCTGCATGT CTAGCGTCCTGCTCGTCACG CG~GEE~TGATGGTTCGC

7 17 GGCTTCTAGCTGCCGGTCAG CTGACGGTTCGTCATCATGC GATGCTGACCTGGTTCAGTC CGAGTCGTGCCGACGTGAGA TCCGCGTCGCTGCTCGCAGT 6 17 G A T T B T G C G C T C G ACTTCGTGCTGAATAACAAT TCGTGCGCTCTGACTGTCGC TGGATATCCCGATCCGCGCT GTCGCCATGACGTAACCAGT

817 CTATCGACCGTCTGCACGACGTACCGCGTGCTAGCGTAGC TCTCTGGCTAGAGCTACCGC TGCGAGTCAGCAACCTGGTGCGATCGTGCTGAAGCGATGA

917 CCATACGGCATAGTCGATTT GGTCAGCTGCTACCGCTGTGCGATCGTCTTCGTGCTCGCG CTCGATCTCTCGGCGCGATGCTATCTGTCCTGCAWTCAA

-%I

1017 TGTCTCAGCTGTGGCCTGTGCCCTCGACTTGGCTGCAACGCTCGGCTTTACCTGCCTCAGCAGTGGTCTGTGGTGCTAGTCCTGCGGCACTGCTGTTTCT

S Q L W P V P S T W L Q R S A L P A S A V V C G A S P e L L F L

1117 TCGACrrATCGCGCTACCCGTCCGTGGGCGTCTGTCGTTGCCGATATCTGCGTGCTACCGCTATGTTCACGGCTGGTGCTCGCCGTCGTCGAGCTCATCC

R L I A L P V R G R L S L P I S A C Y R Y V H G W C S P S S ” S S S

1217 CAGCCGGCGAGGCAGGGCTGCGGGATCGGCGCCGGCTACCTGGTCAGGACAGATGAAAGC GCTCAGTACGAGCCGGCCCCGCGGGAGCGCGACGACGTCC

Q P A R Q G C G I G A G Y L V R T D E S A Q Y E P A P R E R D D V L

1317 TCCAGTTCGACCTGACGGACGAGGAGCCGAACGTGGACCTCGGGCCGCTGGGCACGACGC GGGGCGGCGGGGGGGGCAGGCGGCTGCGCCTCCACGGCCC

Q F D L T D E E P N V D L G P L G T T R G G G G G R R L R L H G P

1417 GAACCGGCGCCCGCGCTCGAGCCGGCCGCGGAGCGACACT ACCCGCCCGCCGCGGCCCGC AGCGGCGCCGTGGCTGACGT CCTGCGCGGGCGCGAGGGCG

N R R P R S S R P R S D T T R P P R P A A A P W L T S S A G A R A

1517 TGGTGCGGCGACCTGGTGAT TTCCGTGGCCGACGTGGACT CCTCCCCGGGGCCGCGCGCG GCGGTCGACCTCGGCGGCGA CGGCTGACTGGAGGTGGGCA

W C G D L V I S V A D V D S S P G P R A A V D L G G D G *

1617 CCCI”PCCCGAACATCCGCAGCGCTTGCAGTGAGGCGAGGGAAGACCGCCACGCGCGATGG AGACTTTCTGAACATGCAGTCGAGGGCAGACCAGTCAGAG

1717CATGGCAGGTAGCTCGCGCCGACGTTGGAGCCGACCGAAGCGTCCTGGCTGGAACTTGAC ATGGCCACGAACATCGCAGCGCTTGCAGTGAGCGGGAGCC

1817 AGCGCGCGGATGGGAGACGC AGCTGAACCATGGCAGTCGAGGGCCACCACAGGCGGTGGAGGAGCTCGCCCGAGCGTTGG AGCCGACGAAGCCGCCCAAG

1917 C T G G A A S G A G G A G A A C-GTCGGCTCGTACC GTTTCATCACGATCCTACCT ATGCCAGATCCTGACAGCAG GCCTCGTGTCCCGGAAGACT

2017 GGTCACAGCTTGTqGTAAG CGGATGCCGGGAGC GACAAGCCCGTCACGCGTCAGCTGG TGTTGGCTGGGTGTCGGGGC TGGCTTAACTATGCGCATCA

2117 GAGCAGATTGT P

Fig. 3. Nucleotide sequence and inferred amino acid sequence of MAEP. The amino acids were numbered from the N-terminus of the prepro-peptide (-64), the amino acid terminus of the mature enzyme being + 1. The putative peptidase cleavage site Ala-Ala at positions -36 and -35 is underlined. A putative ribosome-binding site is indicated by dots. C-terminal inverted repeat sequences are underlined with arrows. Consensus sequences proposed for the -35 and -10 regions of the promoter are boxed. The continuous open reading frame starts at position 1016 and stops at position 1601. The mature protein starts with serine (nucleotides 1208-1210). Amino acid sequence homologous with the N-terminal amino acid sequence of MAEP is underlined.

M13mp19. The 2.1-kb fragment was also digested with Hin- cII and the fragments subcloned into the same site of M13 mp18 and M13mp19.

Expression Since the library was constructed in an expression vector,

we have attempted to demonstrate the presence of an acidic endoprotease activity produced by the above selected clone. 2-ml cultures of DH5amcr strains in LB/Amp (Amp, ampicillin; 100 pg/ml) were grown at 37°C with vigourous agita- tion for 6-8 h. 50-pl fractions of both supernatant and lysed bacteria (with or without IPTG) were applied to LB/agar/ Amp plates containing milk (10 g/l) or casein (10 g/l) and incubated at 30°C for 8 h. Hydrolysis products of milk appeared directly as clear halos, whereas a 10% trichloroacetic acid treatment of the plate was necessary to observe hydrolysis products of casein.

This clone displayed an acidic clotting activity, after IPTG induction, and cell lysis on milk and casein substrates. As a control, M . nunthus culture supernatant exhibited a similar protease activity. No activity was obtained either with the culture medium from E. coli transformed with the vector pTTQl8 itself or with untransformed cells. These results strongly suggest that we have cloned a DNA fragment encoding an acidic endoprotease.

Nucleotide sequence

The nucleotide sequence detefmined using mpl8 and mp19 as vectors, include an open reading frame (OW) of 585 nucleotides, potentially coding for a 195-amino-acid sequence (Fig. 3). The amino acid sequence, deduced for nucleotide 1208- 1318, exhibited a high degree of similarity (86.2%) with the N-terminal amino acid sequence of MAEP.

The proposed translation initiation site is an ATG (nucleotides 1016-1018), far upstream from the N-terminal amino acid (serine) of mature MAEP. It is preceded by a potential Shine-Dalgarno sequence (GCAGG) located at nucleotides 1008-1012. The stop codon of this O W is a TGA (nucleotides 1601 - 1603). Four short palindromic sequences, repre- senting potential transcription termination sites, were also found downstream from the termination codon. These sequences, which are underlined in Fig. 3, could form stable hairpin structures in the mRNA, with a AG of -12.8 kJ and 3.1 kJ, respectively.

The protein could be synthesized as a precursor protein of 195 amino acids resulting in a mature protein of 131 amino acids, produced by scission of a N-terminal64-amino- acid extension. The region Met64-Ala36 could be the signal peptide of the MAEP with a putative peptidase cleavage site

252

Ala-Ala [24] at positions -35 and -36 and a propeptide region from Ala35 - Serl.

Upstream of the initiator methionine codon, two sequences (TAGCTC and GAGCGT) homologous to the M . xanthus consensus promoter, were identified as putative - 35 and - 10 promoter regions separated by a 17-nucleotide-long sequence (Fig. 3).

The N-terminal sequence was located beginning at position 1208. The calculated molecular mass of the mature protein was 13.714 kDa, i.e. in good agreement with the apparent molecular mass of 12 kDa determined by SDSPAGE analysis.

The G+C content of the MAEP-coding sequence (71.3%) as well as the codon usage are typical of myxobacteria, that preferentially choose C or G at the third position of the codon (data not shown).

DISCUSSION All species of myxobacteria produce extracellular pro-

teins. Some of them are involved in the degradation of macromolecules whose transport into the cell is limited because of their size. Growth of M . xanthus leads to the appear- ance of a clotting activity in the culture medium until 30 h of vegetative growth [25].

The protein seems to behave unusually during the purification process. In the course of the first step, we have observed a considerable loss of material. Morever Sephadex G75 yielded four active fractions (Fig. 1 A). Since their properties seem identical (clotting activity), the four enzymic fractions probably represent different complexes of the same enzyme, as previously postulated by Gnosspelius [26] to explain the abnormal behavior of an extracellular enzyme during its purification. Other authors [27] argues that an enzyme (agarase) excreted by Cytophaga sp. was complexed to acidic polysaccharide components of the slime. It can be postulated that the MAEP existed under differents states, consisting of the same polypeptide chain complexed with various carbohydrate moieties. In order to test this hypothesis, carbohydrates were examined for protease fractions. MAEP was probably complexed with unknown liposaccharide or glycoside com- pounds. This would explain any unusual behavior during the purification process, notably the poor yield (0.4%). Since myxobacteria also produce some pigmented material origi- nating from the culture medium, it is very likely that interactions between MAEP and other components (slime, pig- ments) induce significant modifications of the properties of the endoprotease. Specific cleavages were attempted using trypsin and V8 protease to obtain peptides prior to the determination of its primary sequence. However, the purified protease was shown to be resistant to both enzymes [25]. This property is contradictory to the amino acid composition of the mature protein inferred from the nucleotide sequence. Indeed, many sites, near arginine, aspartic acid and glutamic acid, should have been recognized by trypsin or V8 protease. This result could agree with the existence of complexes which protected the enzyme against different attacks. A last argument must be stressed about the presence of multiple consensus sequences of amidation (such as GGRR), myris- toylation (such as GCGIGA, GIGAGT, GTTRGG, GGGGGR) and phosphorylation (TDEE, TTR, SSR, SVAD), especially in the mature protein deduced from nucleotidic sequence [25].

In a previous paper [12], we have described the partial purification of an endoprotease from M . xanthus DKlOl . The

molecular mass of this enzyme had been estimated at 45 t 5 kDa. Whether MAEP represents an active component of a 45-kDa oligomeric structure or an enzyme differing from the former endoprotease remains to be established.

Purification of the crude enzyme yielded a preparation which, upon ion-exchange Chromatography, gel-filtration chromatography and electrophoretic migration, appeared homogeneous. MAEP protein is characterized by an apparent molecular mass of 12 kDa, a pHi close to 4.5 and by the cleavage of Phe-Met bond in K--casein under acidic conditions. Extracellular endoprotease described in the present report proved to be different from other activities in myxobacteria that exhibited alkaline proteasic activities [5, 6-8, 28, 291.

K--casein clotting obtained at pH 5.9 with MAEP results from a specific cleavage of the Phe105-Met106 bond, that occurs naturally with chymosin from calf stomach [30]. MAEP has not been fully characterized (optimal pH and tem- perature, cleavage specificity) but its clotting activity with the K--casein as a substrate and its isoelectric point indicate that it could be an aspartic protease [31, 321. However, these acidic proteases and MAEP protein are very different regard- ing to their physicochemical characteristics (molecular mass and amino acid composition). The only available information do not permit the formal classification of this enzyme in one of the four protease families (such as serine, aspartate, metallo and cystein proteases).

The putative open reading frame identified codes for an 195-amino-acid protein that exhibited a high degree of similarity with the N-terminal amino acid sequence of the purified MAEP (86.2%). The inferred polypeptidic sequence revealed that the mature enzyme is composed of 131 amino acids, thus indicating that the enzyme is probably synthesized as a prepro-enzyme. This hypothesis is in good agreement with the behavior of MAEP, since this enzyme is secreted into the culture medium. It is known that several bacterial extracellular proteases are synthesized as precursor proteins bearing long extensions at the N terminus. a-lytic protease from Lyzobacter enzymogenes [33, 341 proteases A and B from Streptomyces griseus [35], and neutral proteases of various Bacillus species [36-381 are among these proteins. To understand the mechanism of its maturation, it would be necessary to isolate the intermediate forms and to determine the cleavage sites leading to protein secretion.

We attempted to establish a relationship between the isolated gene and purified MAEP. We first showed that the genetic information contained in the 2.1 -kb fragment produced a proteolytic activity towards milk and casein. This activity is comparable to that of MAEP from M . xanthus. However, this result does not constitute a definitive argument to iden- tify the cloned ORF as the MAEP gene. Only the introduction of the O W in an expression vector and a complete characterization of a similar activity would prove that the studied gene is actually the one being searched.

No significant similarity with other known proteases has been found in the EMBL data base. However, according to a structural study, the polypeptide sequence seems to exhibit a high degree of p-turns and antiparallel p-sheets (G. De- leage, personal communication). Interestingly, this is one of the structural features of many proteases (chymotrypsin, trypsin). Sequence comparison with another acidic endoprotease isolated from Stigmatella aurantiaca, called SAEP [lo], showed a significant similarity (76%) with the MAEP- deduced amino acid sequence [25], indicating close structural and functional relationships between these two proteases. A

253

73.5% similarity was also found between MAEP and the C- terminal domain of the decapentaplegic precursor from Dro- sophila melanogaster [39]. During embryogenesis, the decapentaplegic gene (DPP) is known to play a central role in dorsal patterning. Recent genetic studies on Drosophila embryogenesis have demonstrated that external signal trans- mission to the nucleus involved a cascade of proteases (such as serine and metallo proteases). These enzymes would be needed for the generation of localized extracellular ligands for membrane receptors and would regulate cell communication. The homology between MAEP and DPP suggests that the MAEP could be involved in M. xanthus morphogenesis.

To date only a few studies concerned proteases secreted by myxobacteria. However, Plamann et al. [ l l ] have recently demonstrated that a proteolytic activity was associated with the A factor of M. xanthus during its developmental process. Another group [40] has described the presence of a milk clotting proteolytic activity (Mcp), secreted by M. xanthus DK1622 during both vegetative growth and submerged development. This activity yields the clotting of rc-casein at pH 6 and is inhibited by specific inhibitors of aspartic proteases. Secretion of this Mcp activity is time regulated during the development cycle. These authors suggest that Mcp could be a marker for development in M . xanthus.

Finally, MAEP and Mcp could play a similar role in the cell cycle of M. xanthus.

We would like to thank M. Guilloton and A. Maftah for critical reading of the manuscript.

REFERENCES 1. Kaiser, D., Manoil, C. & Dworkin, M. (1979) Myxobacteria:

cell interactions, genetics, and development, Annu. Rev. Microbiol. 33, 595-639.

2. Kuner, J. M. & Kaiser, D. (1982) Fruiting body morphogenesis in submerged cultures of Myxococcus xanthus, J. Bacteriol.

3. Burchard, R. P. (1984) in Myxobacteria, Development and Cell Interactions, (Rosenberg, E., ed.) pp. 139-161, Springer-Ver- lag, New York Inc., New York.

4. Zusman, D. R. (1984) in Myxobacteria, Development and Cell Interactions, (Rosenberg, E., ed.) pp. 185-213, Springer Ver- lag, New York Inc., New York.

5. Whitaker, D. R. (1965) Lytic enzymes of Sorangium sp. Isola- tion and enzymic properties of the a and p-lytic proteases, Can. J. Biochem. 43, 1935-1954.

6. Wingard, M., Matsueda, G. & Wolfe, R. S. (1972) Myxobacter AL-1 protease 11: specific peptide bond cleavage on the amino side of lysine, J. Bacteriol. 112, 940-949.

7. Jackson, R. L. & Matsueda, G. R. (1970) Myxobacter AL-1 protease, Methods Enzymol. 19, 591 -599.

8. Gnosspelius, G. (1978) Purification and properties of an extracellular protease from Myxococcus virescens, J. Bacteriol.

9. Dumont, L. (1993) Purification de 1'Clastase MAP1 de Myxo- coccus xanthus. Etude physicochimique et enzymatique. Re- cherche de son gbne et de sa fonction biologique, Thbse de Doctorat. 42, UniversitC de Limoges, France.

10. Mazaud-Aujard, C. (1993) Une endoprotCase acide de Stigma- tella aurantiaca DW4 : Purification de la pro the , clonage et sCquenGage du gbne, Thbse de Doctorat. 22, UniversitC de Limoges, France.

11. Plamann, L., Kuspa, A. & Kaiser, D. (1992) Proteins that rescue A-signal-defective mutants of Myxococcus xanthus, J. Bacte- rial. 174, 3311-3318.

12. Carias, J. R., Raingeaud, J., Mazaud, C., Vachon, G., Lucas, N., Cenatiempo, Y. & Julien, R. (1990) A chymosin-like extracel-

151,458-461.

133, 17-25.

lular acidic endoprotease from Myxococcus xanthus DKlOl . A potential new tool for protein engineering, FEBS Lett. 262,

13. Davis, L. G., Dibner, M. D. & Battey, J. F. (1990) Molecular Biology, Elsevier, New York.

14. Lowry, 0. H., Rosebrough, N. J., Farr, A. L. & Randall, R. J. (1951) Protein measurement with the Folin phenol reagent, J. Biol. Chem. 193, 265-275.

15. Heukeshoven, J. & Dernick, R. (1985) Simplified method for silver staining of proteins in polyacrylamide gels and the mechanism of silver staining, Electrophoresis 6, 103 - 112.

16. Haselbeck, A,, Schickaneder, E., Von Der Eltz, H. & Hosel, W. (1990) Structural characterization of glycoprotein carbohydrate chains by using Digoxigenin-labeled lectins on blots, Anal. Biochem. 191, 25-30.

17. Starich, T. & Zissler, J. (1989) Movement of multiple DNA units between Myxococcus xanthus cells, J. Bacteriol. 171, 2323-2336.

18. Tautz, D. & Renz, M. (1983) An optimized Freeze-Squeeze method for the recovery of DNA fragments from agarose gels, Anal. Biochem. 132, 14-19.

19. Southern, E. M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis, J. Mol. Biol.

20. Feinberg, A. P. & Vogelstein, B. (1983) A technique for radio- labeling DNA restriction endonuclease fragments to high specific activity, Anal. Biochem. 132, 6-13.

21. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors, Proc. Natl Acad. Sci. USA 74,5463-5467.

22. Pearson, W. R. & Lipman, D. J. (1988) Improved tools for bio- logical sequence comparison, Proc. Natl Sci. USA 85, 2444- 2448.

23. Inouye, S., Hsu, M. Y., Eagle, S. & Inouye, M. (1989) Reverse transcriptase associated with the biosynthesis of the branched RNA-linked msDNA in Myxococcus xanthus, Cell 56, 709- 717.

24. Perlman, D. & Halvorson, H. 0 . (1983) A putative signal peptidase recognition site and sequence in eukaryotic and prokary- otic signal peptides, J. Mol. Biol. 167, 391-409.

25. Lucas, N. (1993) Une endoprotCase acide de Myxococcus xanthus DKlOl : Purification de la protCine, clonage et sCquen- Gage du gbne, Thbse de Doctorat. 23, UniversitC de Limoges, France.

26. Gnosspelius, G. (1978) Myxobacterial slime and proteolytic activity, Arch. Microbiol. 116, 51 -59.

27. Duckworth, M. & Turvey, J. R. (1969) An extracellular agarase from a Cytophaga Species, J. Biochem. 113, 139-142.

28. Christison, J. & Martin, S. M. (1971) Isolation and preliminary characterization of an extracellular protease of Cytophaga sp, Can. J. Microbiol. 17, 1207-1226.

29. Gillespie, D. C. & Cook F. D. (1965) Extracellular enzymes from strains of Sorangium, Can. J. Microbiol. 11, 109-118.

30. Lawrence, R. C. & Creamer, L. K. (1969) The action of calf rennet and other proteolytic enzymes on K-casein, J. Dairy Res. 36, 11-20.

31. Barett, A. J. & Rawlings, N. D. (1991) Types and families of endopeptidases, Biochem. SOC. Trans. 19, 707-716.

32. Neurath, H. (1989) The diversity of proteolytic enzymes, in Pro- teolytic enzymes: a practical approach (Beynon, R. S . & Boud, J. S., eds) pp. I - 15, IRL. Press, Oxford.

33. Epstein, D. M. & Wensink, P. C. (1988) The a-lytic protease gene of Lysobacter enzymogenes, J. Biol. Chem. 263,16586- 16590.

34. Silen, J. L., McGrath, C. N., Smith, K. R. & Agard, D. A. (1988) Molecular analysis of the gene encoding a-lytic protease: evidence for preproenzyme, Gene (Amst.) 69, 237- 244.

35. Henderson, G., Krygsman, P., Liu, C. G., Davey, C. C. & Malek, L. T. (1987) Characterization and structure genes for proteases A and B from Streptomyces griseus, J. Bacteriol. 169, 3778- 3784.

97-100.

98, 503-517.

254

36. Shimada, H., Honjo, M., Nakayama, A., Akada, A,, Manabe, K. & Furutani, Y. (1985) The nucleotide sequence and some properties of the neutral protease gene of Bacillus amylolique faciens, J. Biotechnol. 2, 75-85.

cloned gene to create an in vitro-derived deletion mutation, J. Bacteriol. 160, 15-21.

39. Hecht, P. M. & Anderson, K. V. (1990) Extracellular proteases and embryonic pattern formation, Trends Cell Biol. 2 , 197- 202. 37. Takagi, M., Imanaka, T. & Aiba, S . (1985) Nucleotide sequence

and promoter region for the neutral Protease gene from B a d - lus stearothermophilus, J. Bacteriol. 163, 824- 831.

38. Yang, M. Y., Ferrari, E. & Henner, D. J. (1984) Cloning of the neutral protease gene of Bacillus subtilis and the use of the

40. Petit, F. & Guespin-Michel, J. F. (1992) Production of an extracellular milk-clotting activity during development in Myxo- coccus xanthus, J. Bacteriol. 174, 5136-5140.

Documents

Protein purification, gene cloning and sequencing of an acidic endoprotease from Myxococcus xanthus DK101